Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:131-h11   

Cenix:131-h11RNAiCenix:131-h11
PCR_productcenix:131-h11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY17G9B.9 Source_evidenceePCR315WS150 Sequence/Annotation Release
Overlaps_Gene Y17G9B.9 Source_evidenceePCR315WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV47596244760034
Overlaps_transcriptY17G9B.9 Source_evidenceePCR315WS150 Sequence/Annotation Release
WB_DNA_textTH:131-h11411gcagtgtgtggttctcaggagacgagtgatagtctgaaacatgaaaagttatttgtgtgtaatataaaaccgatttacttactctcttcgtctgtgatcggatcagggttgcaaccacaaagctatctgtcatttggaacctttcgttttccttctctagttgttcgagcaatgcaaataacgtttggaacgacatttcattggttgtctggatagcaaatcgagccacattttgtcccgtttccttcggttcggtcaggagagaagtctgaaatgagatttatgctttatcaaaaatatggccaagaaactaaccagaatcaaactagagatatcctcgaccgacagcttccggcactgagcggcaaaataatgtggtcgttggttgggatgaagaaacacgtgctcgac