Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:132-b2   

Cenix:132-b2RNAiCenix:132-b2
PCR_productcenix:132-b2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C09H10.2 Source_evidenceePCR252WS150 Sequence/Annotation Release
Chunk_score Abs_score193
Max_abs_score193C09H10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1109657611097092
Overlaps_transcript C09H10.2.2 Source_evidenceePCR252WS150 Sequence/Annotation Release
C09H10.2.3 Source_evidenceePCR252WS150 Sequence/Annotation Release
C09H10.2.1 Source_evidenceePCR252WS150 Sequence/Annotation Release
WB_DNA_textTH:132-b2517gctcgaagtgtttgcatctgaaattaagaaattatataaatgtaagatcatcacataatgcattttttaatgtttttgaataaaagtcaagaatgaacgcttttcaggtgaaatcaggtgaatttcaggtataatttttaaattgaaaattcctaaacaagcttttaaaaaatacgacaaaacacacttcatttgaattaatttttaataaaacaaaataaaaacgaacctcttgattgggagttgcttcttgtgcttgcactcggtgcactccattctcaagacgattttcttggtggtcttggccttctttctgaagattggcttggtttgtcctccgaatccagattgttttctgtcgtaacgacgacgtcctaaaaaataacgttgaattttatggtattattattattaatttaaaacgtaccttgagcgaacttggattcctttcccttcttgtattgggtaaccttgtggttggtgtgcttgcggcacttgccgtcacagaaggttcttc