Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:133-d3   

Cenix:133-d3RNAiCenix:133-d3
PCR_productcenix:133-d3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59B10.6 Source_evidenceePCR271WS150 Sequence/Annotation Release
Overlaps_Gene F59B10.6 Source_evidenceePCR271WS150 Sequence/Annotation Release
Chunk_score Abs_score208
Max_abs_score208F59B10.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1052323310524575
Overlaps_transcriptF59B10.6 Source_evidenceePCR271WS150 Sequence/Annotation Release
WB_DNA_textTH:133-d31343cagttggattttctgccgttattttgttgtaggcgtcgaggagtctcctggaaattttgaagaattttgaaatgcccaataagtttggtgtaaaattaactagcaaaattagctagctgccgaaatttcggtactttcaccgttggtgctggatgactcaaaatccgtaaaagattaatttttgttacagtaaataaatgttcttgaattttttttacacttttaacataattttttgtaacagctaggaagatatatacaaacgttggaactaaagaagttaagataattgattatattactctgaaaatactggaaaaacgaataatattttaaagaaaatccagccgattggatgcatcagaaaaatactagaaaaataagattcttcactgaatagtcaaaagaagatgggcgggtattctgacagcatatggccataggtcatttcaaaatttcttttcaaatgtcgtgatgtttatgagttttgttggtcacattgggcagaaggtagagaaaaaaaaagaaaataataagcaaaaaaaaacaaaaaaggaagtacttactgtaattcttttgatcgtgccactccattctcctcgatctttttctcgactagactgagctccctgaaaattctatttggtagttgtttttattaagtctggcattttgaaatgtaaaaccccgtagatggatttgagctgtatgctaaaattaaaatgatacatggcggtttatcaaatatttttaatttgtctgtctttgttttttgtgaattaattaaaagtaatgttattttcagtaagtacatttatttttctatatttttatataaattttgaaaagacaattgggcacaacgattagaaaacggggactttttatataatctgtaatattcaaatgtgccgaacggcatatatcacacatctatgttcaagatcttttcactgatttctaaaaatcataaaaatgttctcataaacttacattttgttaatataacagcaatacataatccaaatcattgacacaataacgtagaaaaatagaacaatccaaaaaatttgagaaacttcatcgaaaagtagatcaattgcaggtttatatgattccatattcacatgcttttccgttacttctaaatgcatttttctaggaataagcatcattttaaaagagttgatagtaagtttcacaatgaaggtaagtgtttgataacccgacgcaaaaatgagcacaataagctcaaaaagcaaagaaaaagcacattgcggtagaaaaaaacgagagagagaaaagacaaacatttgggtcatgagaggaagagggtgccattt