Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:137-e9   

Cenix:137-e9RNAiCenix:137-e9
PCR_productcenix:137-e9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC26B2.1 Source_evidenceePCR834WS150 Sequence/Annotation Release
Overlaps_Gene C26B2.1 Source_evidenceePCR834WS150 Sequence/Annotation Release
Chunk_score Abs_score729
Max_abs_score729C26B2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV80187378019923
Overlaps_transcriptC26B2.1 Source_evidenceePCR834WS150 Sequence/Annotation Release
WB_DNA_textTH:137-e91187atcaaccggtcgagacattctgatgtcaggaacaaattgacgggcaaatgactgaaatttaaactttttacattattgttgaatgagctactcaccgaaattttaaatttaaaggtagtaactccgaagtctcgtttgataagagttctttcgcactcatcacatcgaacttgaactcttccagccagaggaacttgtacaggaaggagtggctcagagatattgatcaatggttgcattatgatttgatcgagagttctcagatcatccgttctttctttaatctcatcttcaagagtcggcgcttctgttggagcatgtgcatcaactggattcatttcaggagccagtgcttttttccgcttatctaccatttgttgaaatccaaacttgtctttcaagtgaaaagcagtccaggctttgcccgattttccctttttcaaatcttttggagcattttcaatcaattcaagtctcttcatgtatgccgtcacctcaccaagttgattaaccaatggattttcttttctgtataaataaaatgtcataagatcatatttacagttagtcatacgttggccaggatttagtattctcttgatcttcttgattcgcttctcttgaagaccaacgacagtactgacaaaccaaatatacattatcattttctgtacgagcactcagaacgttagctgaaaatattcaaatatatttacaaaatagtggataaatcataccacacttaggacaatcattgcaacttgcgcatttatgctttttaagtcttgcttcagggacgcttgatggttcaaggcatcgaggacagaaaatattgtcaacttctcccaagctacagtcatcacacctggaaaagttggttaattttttttttcaattatttttagacaattacccattaaaaaaacttacttaattttgaagcaatatcggcagaaaacaaggtccggaagggttcgaaattttccacaggtgcactcgtatttgattcgactgtactgcagcaactcgctcatattgagaaccgcaaccgctcctaaatgttaaatttttaattcgaaaatttgaaaaagtagcagtttaatgttattttaatcacaaaaattaatgttaaacttaaataattatttttgtaaaaaaaactatttcacaacacgatctcgtccctc