Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:137-g12   

Cenix:137-g12RNAiCenix:137-g12
PCR_productcenix:137-g12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC43E11.11 Source_evidenceePCR1100WS150 Sequence/Annotation Release
Overlaps_Gene C43E11.11 Source_evidenceePCR1100WS150 Sequence/Annotation Release
Chunk_score Abs_score1080
Max_abs_score1080C43E11.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42500794251275
Overlaps_transcriptC43E11.11 Source_evidenceePCR1100WS150 Sequence/Annotation Release
WB_DNA_textTH:137-g121197gaatcgaaaagtcgctggactccatgataccctcgacaaacagcttcgtaaaggagtcgaaactaatcttccacgactactggagcaagtgccagctcttcaatcacttgaagatactctacattcagttcaaatgcgaatgacatcagtgaccaaagaatcaaatcgactcgccacggtttgtgatgatcttaccacgaagcttcgcgaacaaactcgccaactcgaagcaacgatgctcaaaagaaacatggcttcagatgcccaaagatgtgaagaactttttgaatctcttgagaaacgaagtgatttggtgaagaaggcggagatcacatcggagattaaggagatactcaatgataataaaaatttgcgaaaaattggatggttgaagaatatggtggataccaagttgaaagtggctgaaaatgaagttcgacgcagtggagcggaggagttgaaacgaggtttagcgtcattgaatagctcgatggttgtatctgctcaaagagctcttcgaactttgaattatttggattcagaacttgaagttttgctgtcctcctctgttgtcgatctggataagaaattaatggaattatcaaacagctctccagaagttgctaataaaagtctccctgtagtcgctgcaacaattcaatcacatctcgaacaagcggctatgctgggtgaagtctataagaagaaattctctgaaaagttggctcgactgattcgtagcagagttccactcgatactccatacgctttgcggtttgtacagcaattgggtagagtattcaattcaaagggagatagttcacccgctttgaacgattctttacgtccactcaagaactctctcctgactcattcactggctcgtttgcacaaactcgttgaagaaaatgacttctctacagctcatgccaatgcatttgtcgatcttatcaattctgcaatggaagaagaacatcgaaaagtcgactgggacgcggagttgagccagaaaatgagcaataatattgagaaatgcattgagattattgcaaagaaattggaagccaatcttcatttacaaagagatgatttactcctaggtgagctgtgaaattaatacttttttttgttgattttttttatcaaaaacaaaaaaaaattccgaaaacccgagaaaacgatgacgatattttcggc