Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:138-d8   

Cenix:138-d8RNAiCenix:138-d8
PCR_productcenix:138-d8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF14B8.1a Source_evidenceePCR687WS150 Sequence/Annotation Release
Overlaps_Gene F14B8.1 Source_evidenceePCR687WS150 Sequence/Annotation Release
Chunk_score Abs_score582
Max_abs_score582F14B8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX69192156920413
Overlaps_transcript (3)
WB_DNA_textTH:138-d81199atgtctcaagattccgggtgacgatggaacaaaacagaaggatccaaaagccttgagatggcttactcacctgaacgacaagtacatcaaaaaattccttgtatcggagaatacttgtaagaagcactaccaacatattttacaataaaacattaaatatttagatcttccaactgatgaaaccttccgcaacctgggacttccaaaagccgtcagtaccgctcttcgtattggtgaacgcagtcatactgatctgtacgttttttcttttatcagtataattacacttacttttgatgcaaggttgatctgaataaaatttacaaatcccaaaatttcagtcaacgccacggagaagtctcccacaccccagcgccatccgtcgggcgaccaaccattgctccattcgatttcggaaatatggaagaagagaacaaccgtcttccatccaccggtagacgtactccagttgccagaagccaaactcgctactctcgtcatttcatctatgctattccaaatgagactgataactacttgacctgtccagtgagcgcatccaaacgtcctccatttgacccatctcgtaagttgcaaaaagaacgtgatggttttaaaatatagtagtttagaagtctatcaacaccaaaacaccatcagtaaccctggagacgatcgtgctcgttgctataaccgtcgccacaactcgatgagcggagccgacgagatggaactcaaacaacttaatcagacagttcagaaaaaacgttagtcttttttataagttgggctttgggttcatcctttgataaatgaaaaattacacaaaataaccaatttcttagtgagactactcaataacttttcgaaatttagtgtggcaagttgaaatttttatataaaaaaggaaaattttgttaaaacggtaaattttgaacaattttgccacttaaattttttttaaatcaaaatgcttgtatttgtataaaacttgatagttatcatgggttttatttgtttattacacaaatacctttctcctttatcaatgcagtacgcattttgcaaatctgataagttatcactgtaaatttttcagtttcccgcaccatcacaagtggaacaaagcagtttgttgtgaaccccgatgaagcaatccgtgaagagtctccagccactattccaaagaaacgtgccac