Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:138-f11   

Cenix:138-f11RNAiCenix:138-f11
PCR_productcenix:138-f11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26H9.5 Source_evidenceePCR525WS150 Sequence/Annotation Release
Overlaps_Gene F26H9.5 Source_evidenceePCR561WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI93134999314509
Overlaps_transcriptF26H9.5 Source_evidenceePCR561WS150 Sequence/Annotation Release
WB_DNA_textTH:138-f111011atcagccaccaatggaacattatgtgattctggagcagttggagtaaattcaattccatgtacagtctcattggcacaataatacagatatgcggctttttcatcgtgaacccaattctcttgatctggtacagtgacatacggttttgatggttgaaaaaccttcttcacattgatatattttccagcctcatctgctgcttttgaagaccacgcgcctgtcacaatgtagtccgcgtgttcatgatcaccctataaaggaaactttatttttatattttattttttattgtgggtatattgagatttgcctaacttttcaagtcataagatttttttttcattttctaggaatgataaattgttttaaacaacatttttttctagttagggaagtctcaaaagccatcagagacgtgtttcactcttatcataaattataccttaagattgagaggaatagcggcgaattgaccggttccgccgccttgcatgaaaagaatttcaaagttgtctggtacgttcctgcaaatagatttttattaagattaaatgccacttccgggttttctttttctttttttgaaggaatggaagcattttgcactttaattttaaaaaggcttggtgcacaatgtttcaagtttcatcactctagctagttgaactaattacagaataatttcagaaacatcgaacttacataagttcccgaataagactgatagtttcattgagaagagctccgaattccttcgatctatgcgacatttctgaaaatttgtcttgaattctcacaatatccgcatatttcttaatttaccaatgacactgactcctagattattgaaattgagttgttcttcttgcattttaagtaaaacttcttcaggaagctttgctggaccagcagcaaagttaatttttcgtccgggagctgccattttatggagaagagggttagtgtgttttattgatttctgcaaaaatagagtagcggtttcgcaaaaa