Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:139-f2   

Cenix:139-f2RNAiCenix:139-f2
PCR_productcenix:139-f2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F36F2.3a Source_evidenceePCR593WS150 Sequence/Annotation Release
F36F2.3b Source_evidenceePCR519WS150 Sequence/Annotation Release
Overlaps_Gene F36F2.3 Source_evidenceePCR619WS150 Sequence/Annotation Release
Chunk_score Abs_score493
Max_abs_score493F36F2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI90126919013875
Overlaps_transcript F36F2.3a Source_evidenceePCR619WS150 Sequence/Annotation Release
F36F2.3b Source_evidenceePCR545WS150 Sequence/Annotation Release
WB_DNA_textTH:139-f21185attgcgtccggatcatctaccgttgtttccatcaactcttgagatggtataccagtggtacgttttgtgttgagctgaaaaattgaacacttttgctgaaatttcaaactactattgcgaggcggcggctactgatgattgcacgctctttgacgaaatcggtctgcaaattgattacgaatctaaaaaaaacatcgaaaaccaatagaaacattattagaaaagtcccaagaactacaaaaatgggtgttttatcttcgttcaacgcacacacacaatattggatacaaacgagcaagatatagctcatatagatgaaagaagagctccctgaggaggtacaaaaaagaagaggggttgtgaaaagtgaagccggtttaggcattaccatcgggcagtttttgtaccaatgtcctggttgactacaacgattacatgtatatgttggtggaggtggtcctgtcataatgcctggctgacggcgacgaaagctgaaactggttgaaattaaaatagttcttactattagatcaaagtaggtttttcaataaaaactaatgttttcagtgcaaaaatagagggaaagataatcttactttgattgatcgtatgctcttgtcgactggtctctgatatgattgagacgttctgcttcgtccatgttttcaaattctgcctggaaagaaacaaactatttgacagcattattaatcatttacataccgatgaaatatgagaacttggatcaagaaatgaagaagtagcatccaactgattaaccataccagaattcactccagctcttaaaattgattattttatttgacttttacgctctcaaacaataaacttactggactttctgtacttttgcggcgtccttccgagggaatcgttgaactattatagacgaatttctcgggatcagctcatcgtcgctgtatgtcttttttgtgtgagcattctaaaaacaaaaaattataaatagattaataaataataaataaattacctgaagctgcaactcgaagagttccaatttgagattctccttggcacaaatttcgcggacaagttgctcgccacgaatatgcagtccgtcaaactgcagtgtcttgtaatcaagttccgcacggaacttgtagtgaattgacgacatttaaaaaccctcgttccgaaactttt