Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:139-f4   

Cenix:139-f4RNAiCenix:139-f4
PCR_productcenix:139-f4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF40F9.6a Source_evidenceePCR937WS150 Sequence/Annotation Release
Overlaps_Gene F40F9.6 Source_evidenceePCR937WS150 Sequence/Annotation Release
Chunk_score Abs_score874
Max_abs_score874F40F9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV97305229731717
Overlaps_transcript F40F9.6b.2 Source_evidenceePCR937WS150 Sequence/Annotation Release
F40F9.6b.1 Source_evidenceePCR937WS150 Sequence/Annotation Release
F40F9.6a Source_evidenceePCR937WS150 Sequence/Annotation Release
WB_DNA_textTH:139-f41196gggaacttatgcttgtcccatgtaaaatatttctttccgtcggtgtgctcaatgtcaagccagattacatccatgggcatatcgtgatcatcaaatccttgatttacagtagctacgtcttgttcatcattataattccagcgacattgatgatatccgatagagaagagaggtggaagtggagtgacgcctgtcagctttgaattctggcgttggacatctgaaaataacatcgtttaagattcgaacaacagcataatgtatttaaattttgactaaactgattttcaaattgaaaaaaattaatttgggaaaaccgctcgaaaaaacgaaacattttctcaaattgttaaaataattactaaatttgaaattgaaaacttttatgtttctttcagtattaattagtaaaattctacgcagtaaacttacccttcacagttggtccaacgaaaaagaaaacatctacaaggccggattcagatataaagtgagcatcaaaatgtggaacattatcactggatccagtcactttgtcgagcatttttccaaaaagtccctttgatgtaacagatgactgagtgtcaacccatgtttccgctgcgttgaaccataatgctccaaccgatctgttagcacggtgagccaaaatgtatggaattgaaacataaagtgccattggattgttcagttcatactcgaaaacatctaaattgtaaagacggtaaggatcactgtttccgactgtattgcgaagagcaaacgcgtcagcgtgttctggaagaccataggcagttttgaaattgacaaatgaaatgtcgactccgacgctgcttgagccgtgttgcttgtgatcagtgaatcctttgaatcgttcctcccagaatccttctggatactctttgccctcttcttttgtgcggaactcttctacctgaaaatgagagatttattgtacgattctggttttatttcgaaaaccttgagttttccatccctattaagttgagcaacgagctcatcaaattcgttaaaaatgctgacgaggaatggtttataggtgactacaactttcaattttttatttcctccaataatcttagcctcttgatctccattctcgacactagaaaattctagttcttctggaagagaaaccaatgctggattcggaacataacgctttcggattgcac