Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:14-c10   

Cenix:14-c10RNAiCenix:14-c10
PCR_productcenix:14-c10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC24G6.1 Source_evidenceePCR642WS150 Sequence/Annotation Release
Overlaps_Gene C24G6.1 Source_evidenceePCR642WS150 Sequence/Annotation Release
Chunk_score Abs_score558
Max_abs_score558C24G6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV55390825540374
Overlaps_transcriptC24G6.1 Source_evidenceePCR642WS150 Sequence/Annotation Release
WB_DNA_textTH:14-c101293atgcgaggcagctgtaaactgaaagcattaaaaagtcttaaattatttcatgattgaaaagcagatggttcaataaacaaatccttgaaaactattaaatctgcatttaaaaatgtactactgtaactttaaaggcgcattacaaaataattccacagcgttgccagaccaacacatggaaaatgaccgataccgtagtttttgtgaattctttaccaaattccatttcgattccattattctttttttttaattttaaacttcgcttctgagaatttttgaatgaattctgcccatcgatcttcgctcaaaaagcggccaggaccccaagatgaccgggtaattgaagtcttcttattggttcactaaaaatattgaatctttagagagtcagcttcgcatctccagtgtcttcttcacagaaaacagctgcagtaactgtggcggcccaaactaaacaacctgcaaaagcgaaaaatcttcgaactatgcattccacgccgaagaaatcgaaacctgctcatgatgtggccgatataatttcagtatgatccaatgttattcagaaaataaatcaattaaaatttatttcagcttgtgagtaagcaaagcgacatattggatgacgtttctgaaattgaacacaaaatgatcaagcaggcgaaaatgacacaagatctgacaatggagctggcaaattcaatcgaacgtatcgcaaatatggcattagccgaaagtaaactcagcgaccaaatggagaaacagtcaaagaagctcatttctctagaaggaaaaacaaaagagctcgtcgagaaagccaacaattggtctaaaacactcgaaaatgtaagaattagataattagtaaatatatatttaaaaatttcagcgcgttgacgccagatcgcatcattccacttgtctcaatgatgttcaggcggctataaaaataatcaataatgcaaaaatcaacaacgatgggttctcggaagatttctctgctcattacgacaaacttctggatttggttgaaacgctcgagccgtgggctgacaagttataaatcatctgttgtattcaatttccttgttttattacatgacatgtatcattttaatgtttgtccatcgtattgcatgtattgctttctcaaatatgggaacttttttttttgaaaaaaaaacaatccaaaatccatatttgaccaaaatgaataaaattttgtttaaaaactcgcatcactcaactttcacagaatgcattacgcctccgccgcataggacacaggacaaa