Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:14-d10   

Cenix:14-d10RNAiCenix:14-d10
PCR_productcenix:14-d10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25A1.9 Source_evidenceePCR1215WS150 Sequence/Annotation Release
Overlaps_Gene C25A1.9 (3)
Overlaps_transcriptC25A1.9 Source_evidenceePCR1273WS150 Sequence/Annotation Release
WB_DNA_textTH:14-d101690cacttaatgcgcccattttcaacagaaaataacgctcgagattcgaattcaattctctcctcccttgcaattttcgtgtcactatgccaaccgacgaaccttcgaagcgaaaatccattttaccaacgattccaacatccctgatgttgaagaaaagtaacgaagcattgagtgacttcgaacgtgagttgggttcagcgaaaatgtattattcagcggtattatctttcaggaacatttaatgatcgagttatggatatatttgccgaaaatcgaagaatagatgtagaggagtttaaaaaaaatgccgaatgctttttaaacatcattcgatcgaacaaaatcgatttaaattggggtgaagggggagaaagtagatatgtgacgataactcgattaatggtaaggttctcggtgaattcaataattaagaatgtgcaattattcagaaaatactcaaaacttcaccacaatcaatcaaagatctacttccacataacacagtgtcgaatttcgttaaaataaccaattataatttaacaattgatatcactcttttaggtttgtgcaaagcagggagttcttattataaagaatttgaatttcagaggagcttgtacgaacagtcattcacgctgaggagtcctacatcaaacttcttccattttcagaaaatagcacagagatttccagttatgtaagtatcttatttctactctaaaagctattatcctgacactattttcagagtctccaagactttgtggccacacattttattccaattatgattgaagaaccggaaaatcctgtctattatacagcttacgcagttggaacaatatttttcctattgggtgctcgacggcgagactgtgtatatttgaaggatttacttgcttcaacacttctactacaactcgaagagtgtattcatgcagagaatcattgcttatcacctccgaaaattgatgtgtatgatttatcagtgccataaattgcttcaaaaagtcttttttcagattcaccgtcgctcaatttcgaaccactttatcagaattccgattccttgactcccaacgaaagggattgttggcgccagcggacttgaaatttttcagagagtatgaagaaattatttttcagtctataaatcctatttttcagcggaatcttcaatgaggttttcaccaagcgaatcttcgaaatttcaataacctatgaagatggacgtattgatttcaaagcgttcgttgattttgtcaccgctctaaagttccgtcatgtaagcgattttttaatcagaaccaaaaaattgttctaaaaaataaatttccagaccactgcctccgccaaataccatttcgaaattctggatctaaaggatgatggactgttggatgaggaagaaattcgatcaatagtgagtaaaactctccaagaacactttctcatcgcttaaaagtcatcatttcagcttcaaaacctgccagattacgtcccggaagataatagtgtgaacccggaagtagcaactgccgaactgagagatatgatgcgtctgaatcagaatggaattacattggaagagtttcttgctaatcggatgaactcgacgtttgctggattcctctccaattccgatgattacatgaagtacgaacgacgcgagcaatagcagtcccgctaa