Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:14-d11   

Cenix:14-d11RNAiCenix:14-d11
PCR_productcenix:14-d11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC43E11.4 Source_evidenceePCR1187WS150 Sequence/Annotation Release
Overlaps_Gene C43E11.4 Source_evidenceePCR1187WS150 Sequence/Annotation Release
Chunk_score Abs_score1124
Max_abs_score1124C43E11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42477814249147
Overlaps_transcriptC43E11.4 Source_evidenceePCR1187WS150 Sequence/Annotation Release
WB_DNA_textTH:14-d111367cggcattcacacgatctctactattcaatcgatgctcaacatcttcattttgtaattcaatcacacgaaatgccgtcgctttctttgccactgcagctgctacgccaaaaatcaatgtaaatgtgggaactattggacacatcgatcacgggaaaacaactctaacatcagcaatcacaagagttcaggctaaaaaaggtttaattaatttttatattattcacaaatgaattcaattctgcaggttttgcgaagcatattaaatttgacgaaatcgataagggaaaagaagaaaagaaacgtggaattacaatcaatgtcgctcatatcggctatgaaagtcctctgcgtcgatattcccacactgattgccccggtcactcggatttcatcaaaaatatgatttgcggaacttcacaaatggacgtggctgttcttgtgattgctgcaaccgacggagtcatggagcaaaccaaagaacatttgattctagccaagcaagttggtgttaaaaatatggcgattttcatcaataaagcggatttggttgaagaagatgatctggatttggtagaaatggaagcacgggaattgttgagtctgcatggctttaatggagatgcgactccagttattcgaggttccgctttaagtgctctagaaggacaagatatttcgtgtatcgagagattgattgatgcattggattcacttccagagccggatagaaatgaaaaggatacttttgtaatgccaattgcatcgaaaactgctatcactgggcgaggtaattgaaaaaagaaatataaggtgtgccaatcaagaatttattttgcaagaaaaagtgcaagaaatttcaataaatgacattttttgccacccctaatatttaaaaaaaaaccaatttaaaatgtttttcaggaacagtcatcgtcggtacactggaaagaggtgtcttgaaaaaaggcgataaagttgaaatcaaaggagacgggcaaactcttcaaacgactgcttcggatatccaagtttttggcaaaagtgtgaaggaagttcgtgctggagatcattgtggagttctgtgtagaggagttaaaggggatacagtgaagagaggaatgtgggcaggacatccaggagcagtaacaattacgaatcgagtgaaagtggaactttatcttctctcggaggctgaaaatggcaggaagatcggaattcggactggtttcacagacaaaatgtactgcagtacttgggatcaagttggtcgtttcgatatgagcaatgagcttctgatgccaggagaacatacttctgctacagtactcttgatgaaagacatgccactcagaaaaggaatgccgttt