Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:14-d12   

Cenix:14-d12RNAiCenix:14-d12
PCR_productcenix:14-d12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54G4.9 Source_evidenceePCR1241WS150 Sequence/Annotation Release
Overlaps_Gene C54G4.9 Source_evidenceePCR1305WS150 Sequence/Annotation Release
Chunk_score Abs_score1221
Max_abs_score1221C54G4.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80247328026358
Overlaps_transcriptC54G4.9 Source_evidenceePCR1305WS150 Sequence/Annotation Release
WB_DNA_textTH:14-d121627ttgtgagacctgcgtatccacttttataacgatgtctgcaaccttatcgtagaataaaagaaagctcaaaaacagtttaaagataatttttctttcctgaaaataacttaattacagctttttggaataaaaaaaaagagcgaagagaagtttttttattaatttatcaaagaaaatagatattcaaatgaaagaccaattgaaaaaataaggaaagtatgtttcaaaaatactcgtcggctaattttctttcataaactccaaaatccgatcctcagcatttttgtaggtgcatgtcaaaatggaaaagtagcttgcgccgatattttggtgctccaggcgcattacttcttcctcactcgtagctttattggattcaacttgtttcagcttgacaaagtcgacaagctgctcgtgcatcggttgaagaatcttatggtaaacttcacgacagagctcttttttaattttgaaaactgcttgtgcctgagctagtgcgaacacagcagagaagtagacagttgcaaaataaacgtcatcgtatttaatcttcaaacacagtgcccaaaattcaccaagttcttcataaaattcaggtgacctgaggccgaatgcatttcgctggtaagttgtgatgatggttgcaacaacttgcggttccaaaccaatatttgtatctttctgaatgagaaatttttaatctttaaaaatacaccaacagaaatcaaaccttttcggaaatttttttaagaaaatgcttcagaaacagaggtctgcttttgagagaatatctagaagctgttttctctaaaagcttggctgattctgttatgtcgttcatcccaattccatatccattgaatattcgaagagcagcaagccaaaattctacaattttatcaatttcgggagcttccaattgagggataagctccattcgtttgtaaatctgattaaacacttgaagcatctgacatgcttgttctttgtgataagttgattcaatttgaaagaaatttgtgaactctttcacttccaaatggaatcgggtctcttctgaaacaacgtgtggaatataaaaatattcggagtccttcttgaaatcttcgatcactgaaatacgcatttttcaattgaaatttaattctacaactgctcttaccgaggataggatgaaagggagaaacaatagcgagctcatttagaaatttcatgggaatgttgaccttatttgcattgagcgatattataacatccttgagtaatttttcaagaaatcttttcggagctccagataacctcagaattctacaatttgcagtcattcttcttgcgagaatttcgattttttcagtatttttcgcagactcgatttgtttccagacttctctacaatcatctgttcttaaaatccagccgtgcctgtaatagtaaaaaaagtgaacaaaagctgaataaaataaaacctactctatcattatctccactgcaatttccacagtgacagatgattgttgtttgattatatagttacacatttcttccaacaccgcttgattttccaatcgattcatcatttgtcgaactaccgtttcagatatttctagagaaaccgtcaagtcccatg