Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:14-d9   

Cenix:14-d9RNAiCenix:14-d9
PCR_productcenix:14-d9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14C10.1 Source_evidenceePCR814WS150 Sequence/Annotation Release
Overlaps_Gene C14C10.1 Source_evidenceePCR814WS150 Sequence/Annotation Release
Chunk_score Abs_score709
Max_abs_score709C14C10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1259091812592019
Overlaps_transcriptC14C10.1 Source_evidenceePCR814WS150 Sequence/Annotation Release
WB_DNA_textTH:14-d91102aacatctcctcgcgatcacttgctttttactaacaacttgtattgaaaagtaatattttcacttgaggaaaagtttcaaaacttgatccacttcagattatgaatccgttttcggatgttatgcggaaagctctctgttcttcaccacaatcaccatcttccaattctactggacttgttccgtttggaagtccaaaattctatgtcttgtgcggaatgggtggatcaatttgctgtggatttactcatcttgttatcactccactagatattgttaagtgtagaatgcaagttgatcctttgaagtacactggagttgttcaaggattcaaagttgccgtagcagaagatggtgttagaggttggtaatatatacacagtaatttgtaaattctgaattgatttttaggcttggcacgtgcttgggctccaactacaatcggatactcagcacaaggttttggaaaatttggttactatgagattttcaaaaacgtctatggaagcatgctcagcgaggtttacttcataattcatgaaatcaaatcaagattttaatttctaggaaaatgcgtacacctatcgttcttgggtgtatctagccgctgcttcatcagctgaattctttgctgacttctttttggctccatttgaagctgtgaaagtgagaatgcaaacttcatcaactgctccaaaaacaatgagagagtgtatgccaatgatttacaaaaaagaaggaatgtacgggtttttcaaggtatagctgaatgataacgctacgttcaagtattaatattcagggactaccaccactttggactcgtcaaattccatatacaacagtgaagtttgtatgtttcgagcggataatggagttgatgtatactcacgttgttcctaagccaagagctgagtgtactaaaatggaacagcttttggtcacattttcagctggatatttggcaggtacacttgaattttagatggaatttgaaaagtttaatgaatcctgctataggtattctgtgtgctgttgcctcgcatcctccagatgtcattgtctcccaactcaatcaagatccgaatgccacgttgacgagta