Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:14-g4   

Cenix:14-g4RNAiCenix:14-g4
PCR_productcenix:14-g4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07F5.2 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (29)
Overlaps_transcriptK07F5.2 Source_evidenceePCR434WS150 Sequence/Annotation Release
WB_DNA_textTH:14-g4931cggtgatagcagctggaaatttatgagggatcatctgagacatcctactatcgcttggcactatctttatctcgatgtcagggacagttttcaaacactttccttgtaaagaaaaaatttgcattttcaaattgttatactatgaattttaaagcttggtgaccccaaatctttacgatgataccacaaaacaactaatcaactagtacttagtatttcacagaaaacaaataggttttttgttcctcaatatggcaaactatcagaacagtgcaaatttaggaaattattcaaaacagctattagctaaaactgattttctttcaaattttaacgtaatctcctatttttggatgaatttttagatttagggcagagataagaatgttgctataaatttggaagattttgccataatcttcatagagttctcataactccttcatcgaacgaccatggcccaatcagtcccaccaggagacatccaaacccaaccaaacgcgaagatcgtcttcaatgcaccatacgatgacaagcacacctaccacatcaaggtgatcaactcatcggctcgtcgtattggatatggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagctgtgcttcttgctgtttcctgcgatgcttttgccttcggacaagaggataccaacaacgaccgtatcactgttgagtggaccaacaccccggatggcgctgccaaacaattccgtcgtgaatggttccagggagacggtatggttcgtcgcaagaaccttccaattgagtacaacccatagagcccttattgatttattcaataaatgagttttaaaagtctttttttctgtttttgaacttttcagattaaaaaaataccaattccggtccc