Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:140-c2   

Cenix:140-c2RNAiCenix:140-c2
PCR_productcenix:140-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH27M09.2 Source_evidenceePCR636WS150 Sequence/Annotation Release
Overlaps_Gene H27M09.2 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI68503666851302
Overlaps_transcriptH27M09.2 Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textTH:140-c2937tttaatgtcggcggaaaactttttaaaagtagtttattgcagagactaacagtaataatggctgacgacgagcttgagacctatagattgtggagaatccgtaaaacagttcttcaggtaaacaaaatttggtatttgccatgataatatgttcatatttagatggttcacgatcgtggttatctcgtagctcaagatgaattagatcaaccattggaaacattcaaagtgcagtacggagatcgtccctctgaaaaaaagccggctcgctcagatctgacaattctcgtggctcacaacgacgatccagccgatcaaatgtttgttttcttcccagaggacgccaaaattggaatcaaaactattaaagctatctgccagcaaatgcaagaacagaatatctcccgtgctatcattgtcgtacaaaccggaatgactccaagcgccaaacaatccattggcgacatggccccaaagtacatgttggagcactttttagaggctgagctcatggtaaacatcacagaacatgagttggtaccagaacatgtcgtcatgacagccgaagagaaagcagaactacttgctagatagtaagtcttcatattaaaacatgattataaatatgatattttcagcaaacttaaggattctcagttgccacgtatccaacaatgtgatccggtcgctcgttattttggtctccgccgtggacaagttgtcaaaatcattcggccatcggaaactgctggaagatatatcacttatcgtcttgtggtctaaatcttttctaaacccccttgaacgttgatcttggcccaaaaattttctgattttgggtacctttgttattttattttttgtttttcccgttattaaacctatttctcttgtatttcaattaaatcttattggaaaatcggtagaatccaatgcg