Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:141-b12   

Cenix:141-b12RNAiCenix:141-b12
PCR_productcenix:141-b12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY110A7A.17a Source_evidenceePCR808WS150 Sequence/Annotation Release
Overlaps_Gene Y110A7A.17 Source_evidenceePCR820WS150 Sequence/Annotation Release
Chunk_score Abs_score715
Max_abs_score715Y110A7A.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI51260365127204
Overlaps_transcript Y110A7A.17b.2 Source_evidenceePCR817WS150 Sequence/Annotation Release
Y110A7A.17a Source_evidenceePCR820WS150 Sequence/Annotation Release
Y110A7A.17b.1 Source_evidenceePCR819WS150 Sequence/Annotation Release
WB_DNA_textTH:141-b121169aaggtgtggatccaggagtggattgtcttggagtgatgtttgatgtggtatctgtaacttttaatttctgattcagcatgatctttcaaaaatttttaatagtggattttgaaaaatcgcatttttagagtcggatttttttctaaactgatattccaaaattttattctccaaaaaagaaaatcctataaatacttcctataaatttacggaaaatttttcaatagttttttccgcttcactcacttcttgtctcgcgattcgccgaagcaatcgtaccgcgtgtagatcgtctgaccgaactttccagtctggaaggttcagcagtgctggcagctgaagaagacgacggcccaggaacatttggtgatggtgtttcggatttcaaactcgaagctggactatccaggtatagaccatttctataaaaatgtcggcataatatttaaatttaaacattctcagaatcttacgattttcggtgatgtttttcaaaagtatgggcgagatcatgacctccaaaccgtaaataagttatgatagctgaccacaacaaaatattctcatccagagacttttgacaagattctaaagccagatccatgtaactttcatcgcaaagcatttgagcatgaagcaaattagcatgtgatgcaacccgtggctcttccaggatatctttccgtatcactccatcgtcatgttcgaaaagagctcctctacagtcatcgattctaaagaaaaattaaaataatgaataaatatacatatatattacaaactaacttatttaaatcgtaggatacccttgcaagtagatagaagagtctagctccgctcaatttaactgaactaaggagaccataacattcctctttcttattggctctatacagacaatcagcgtatagaagaagagattcggagttgttgcctgaaaaaaagttattgaaattaaaatatgaattaaaaacgaaaaccacttttatcggtttcgtaatgaagctcggctagaaaaatagcatcatcaaaagcgtaacacttcatcatttcatgaatctcatcttcaattgttcggtgtgcgtccgctggaaaacgctcgaacacctctctcaattgaggccgcacagctacagacgcagctgattctttcattctcttcgcgacct