Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:141-e10   

Cenix:141-e10RNAiCenix:141-e10
PCR_productcenix:141-e10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W05H7.4a Source_evidenceePCR958WS150 Sequence/Annotation Release
W05H7.4b Source_evidenceePCR958WS150 Sequence/Annotation Release
W05H7.4e Source_evidenceePCR958WS150 Sequence/Annotation Release
Overlaps_Gene W05H7.4 Source_evidenceePCR958WS150 Sequence/Annotation Release
Chunk_score Abs_score895
Max_abs_score895W05H7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX14406291441823
Overlaps_transcript W05H7.4b Source_evidenceePCR958WS150 Sequence/Annotation Release
W05H7.4a Source_evidenceePCR958WS150 Sequence/Annotation Release
W05H7.4e Source_evidenceePCR958WS150 Sequence/Annotation Release
WB_DNA_textTH:141-e101195agcttggctcatctcatcgtgatccgcttgctgatcaaagcgagagcggaacgtccggcgaggtggctgctcgtcaaatcgatttctcctcggtggccgttgatccatatcctggcctggagcatcatcttctccctgtctatcaaacctactgacacgggctctcttagtcggaacgggatcctgatactgggatccatgtgcatttggggatcctagatgaccgccatcatcattgtacgctggcttctggtcgaatctcgagttgttccgaggagcaaagcctccacgagcatatcgtgctccacggaatccttcagtgtcgccaaatcggccacggtttccgcctgcattgtctctaaagtcgcggtcgtggtggttgttgtagttgttgcgattgttgtagcctccacggaatccgcggcctcggccacctcggaagttgtcgtggtgatgatttggaccgcgtggtgggagctctgccatcttttgacgtctctgaaaaagaaataagtaagaatggaaaaaaaatagcttcaaactgccacttaccatctcctcgtcatgaataaatctgcactgatctccccgattacatccacccgggcggctgataaagtagacacatggctctggaatcttccagccggattgagtccatccttccgagttgcgagagtcctggcgacgctcctgagccatcatctctggagttgcaaatgttgcctgaaattttagactgttgctaatgtataaataaggaggacttggaccagcgtcgtgtaaaagtgggccgataccgggcctgtcccgtttttgaagtaagcttccatgggcccacacatttttaaagcgggtcggaccatttcaagcaattccagcccgtttttaaaagcgaaaaaaactcacgacatatccatccattggataatcttgcggcacttcttcacttgcatacgtgttcccctgctggagcatcatctgctgagcagtctgcattgcagccgccagtggatcaaccggcggtggagctgaagtcgtcggcgaaggagtctcatccgacgagacgaaccccttcttcttgagctggttgagcatctccttgaggttcgatggaagctcgaatctgctggcaggctgggctgctggagctggctccggggtctccgggacagaggtggtggccgtgtagtag