Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:141-f9   

Cenix:141-f9RNAiCenix:141-f9
PCR_productcenix:141-f9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene W02B9.1 Source_evidenceePCR521WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI1108123911082410
Y52B11A.11 Chunk_score (3)
Overlaps_transcript (2)
WB_DNA_textTH:141-f91172tggggaaaaagcatgaaaaatgttcaaaaatccgattttaacataatttcaaaggtttttttttaatgccaaaagactgaaaagaaaaaagctgaatttttgtttagaaagcggctttttgtttgatacagttgtacttgattttgaaaattgctctaaaagttggcctttcaaaacaaaaaaaaattcccgagtattttgaaccaaaatcggtgaaaacgttaaaaacattcggatttatcgttttttcgttcaaaaattcgcatttttgtatagttttctctcgataatttccaattttttaacgcttttttctataattagttcgaaaccgtacgtcgtcataaagctaaacgagatgttcaggctcgtacaagccggcatcggcttataccacgcaaatccgtttccaccaaagcttctagttgttccctggcatcgtgctcccttcaatccatcattacggcattcacaaaagaatccaggattcgtattatgacacacaccatcattatgacaaagggaatgctgacaagccggtggagctctccacacggggcatgtacaatcatcacgtgatgttgcattgactccgacaatcactgttgaattggctgatacaacaattccatcatagtcagcagagttgagagtctgacatccggcatcacactgtgtaaacttgcacatatcaattccgactccaacaatttcgacgttaagctttcgttgaagatctgctcggtgagctgcgatgagtccattcagttgagctgtatcacgataagtagagccacgagcgttgaaacggacattcaagactggaacatctcgggtctggagggtagcgattccgacctgaaaataattggaaattaggggaaaatggagattttaaagaataaatatatagagtctaatctagaaaaaatggcattctttctatattttaaacctaaaaatcgtatagttttgtgactattgctattcaaaaagaagaacttttagcagtttcccaaaatttcacgtttttattgtcaaaaaactaagatttttcgaattttcgtgaaaaattggtttttttaaacaaaattcaagatatagtcaaatatctgaaggtaaagttgtgattttccttcaaaatatcaaaaattgccatacttttggggaaa