Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:142-e1   

Cenix:142-e1RNAiCenix:142-e1
PCR_productcenix:142-e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y17G7B.18a Source_evidenceePCR566WS150 Sequence/Annotation Release
Y17G7B.18b Source_evidenceePCR575WS150 Sequence/Annotation Release
Overlaps_Gene Y17G7B.18 Source_evidenceePCR590WS150 Sequence/Annotation Release
Chunk_score Abs_score527
Max_abs_score527Y17G7B.18
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1210682612108023
Overlaps_transcript Y17G7B.18a Source_evidenceePCR576WS150 Sequence/Annotation Release
Y17G7B.18b Source_evidenceePCR590WS150 Sequence/Annotation Release
WB_DNA_textTH:142-e11198cgtgcaactccaatcaaatgctcatcaatatcaattccgataattcgacgcggcgagaagtcttttgcgatggaaagagtcaggaaaccagcgttacaacctgaaatattggaaaattcagtgaaaaaagaaaattttgctctaaaaattagattttagagcgcttttgagtgaaaattagaaatttcaaaatgaaacatttagtgaaaaagtctgaaaattgtccgaaaattcaaattttcaccgaaatttttccgtaaaattcaaaatttctagtttaatatcggttttttgacgatttttctcaagatttttggcttaatttctacaaaaatccaagaaaaatccttttcagcttttccctattttattaccaatatcaagagcctgcttgtgctcgaaccaatccttctgaaaaactgaaagccgcttgtcagactctccaggattcaaacggattccgtaatatctgtcgaaattcccgtatcgatattttttattgaaatattcggttttttgtttccgattttcggcggcacttttctcctctttactgagttgtggggggcgacgggagtcctttcgcggtgaattgtattgatttttctgcaatttctgagagaaaattagataattttatggaaaaatagagattttttgggtcaaaaatcccaaaatccaaaaaatccccaccttaaacggcgaattttcggctggtttctccgatttttcatccttttccaccttccgcttcttggaacgctcggtcgttggatccagaagccctagacgcttcttctcctcttccggattctcggttagctcgatttcaatgttgagcgggtcggttttcgagcctcctggcgcgaaagtgtcgcggtagaagcgttttcggcctcgaaaggagccgcggcggtggctggacatggctggacagctgaaaatcgatagttttgagtttttctgaactttctggcaaaaaattgaagaaaaactatagaaattgagcgaaaaacgatgaaaaatctattttcgtaaaaaaattccattttcaaaatttcgcaatagagcgcacttgcactatttcatttgcgcgggtttttaaaaacgaaaggtcaaaaaatgtggctagcaccagagagaggaagatgtgcatgtgcgcggagacacagagcacagagcacagagcagcttcatg