Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:143-e3   

Cenix:143-e3RNAiCenix:143-e3
PCR_productcenix:143-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10B5.6 Source_evidenceePCR769WS150 Sequence/Annotation Release
Overlaps_Gene T10B5.6 Source_evidenceePCR769WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV18688731869863
Overlaps_transcriptT10B5.6 Source_evidenceePCR769WS150 Sequence/Annotation Release
WB_DNA_textTH:143-e3991atttttcggcaaactgcaagctttttaacaaaaatgagttttattttcaaatagaaaaacccgttttctatcaattttagatcaaaaaagttggattttcatattaaaataagccatttctttgttttcaacgttattttctcatttttaatcactaattcatttcagaatgtctcaaaaatcaaacgacaccacattctcggtcagagccgcgctcttcgcatcacccgtcggctcatcatcagcagttccaaagaagaaagtggctcgagaggtgccacgtgcagggccgccagtttttgccctcgagcacgatgtttcggaagtcaccgacagaaataaagacggcacctttctggctgcagacgcgtgcgctagtggccctactttgaaggttccagacgaaacacaaggttgcccagaaactttcagtgtttcggaacacgaagatgacgacgacgttgagccgatggaagttgatggaaccatcgttccgtcgccccagcgagcaacgccgacacgtggcgtaactccttgcgaaaaatcgacgactccacgcagaagatcctcgagaaagtcgatgccaacgcctgggaagcgtctgttcttcaccagcaaagacactacgaacgaggatcgcaaggctgatgactcgacgcaactggagcttctgatggcaaagattccgcaggagatgtcgggttacatgaaaaagttggccaccgacatcaaagaggtagtattatcgatttttaactttacatttaaatctaaaattttcattttcagatgagccaatacgatgcacagctggcgcggaatatcgacgacatggaagcggttttcaaatcccgcgaaactaagctcaagtcagctattgaaatcgccaaggacagcttcatctcgtccgctctgcctcttcgcctcgagaccctggacatgactctgcgtaaagaagaatcgccaaatgatatcgttgcgagacttcacg