Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:143-e7   

Cenix:143-e7RNAiCenix:143-e7
PCR_productcenix:143-e7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W03C9.3 Source_evidenceePCR574WS150 Sequence/Annotation Release
Chunk_score Abs_score511
Max_abs_score511W03C9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1196582611966934
Overlaps_transcript W03C9.3.2 Source_evidenceePCR572WS150 Sequence/Annotation Release
W03C9.3.1 Source_evidenceePCR574WS150 Sequence/Annotation Release
WB_DNA_textTH:143-e71109caaccgaaatttggcagtttttcttgatttctgcgtacttttttcacgattttaaagctattttcactatataactagtttttaattacaaaaaaatcaatttccgcccgaaatttcacattttttaatttcacaggaaaatccaatttcgccgcatttttacctgagattctctagccaacgcatcacgagcaattgccaaaaatgcggcttcaacgttgagagcttccttggcagaaacctcgtaatacggaatatttcccttcgtctggcaccaagattgagcacgttttgacgaaacggcacgctgtgactccaaatccaccttgtttccgagcaggacaaacgggaaatggtctggatcgcgggggctgcaagaatttgaagttttatagaaaaaccgtggatttttcgaattttttggagaaaaatggtggatttttccgttttattagagaaaaataatgaatttttcagtttttttacagaaaaaatgtgatttttctaaatattccccgtacctagcctgaatcagaaactcgtcacgccacgagtcaagcgatttgaacgaggcggcatttgtgacgtcaaaagccagcacacagcaatcggctccacgataaaaagcgactccgagcgattggaaacgttcctggccggctgtatcccagatctgaaatttttgtgtaaaattttgtctatttttgataatttttcacctgaagagtgacggttctgtcgtcaatgtttacgtcgcgtgtgaggaagtcggctccaatcgttgcctgaaggagaaatttgtttatatttcagggagaattttgagtttaaacaaaaatttcagtttctaaaaaaattgacaaaccttatattgattactaaatcgccgatttacatattgattcatcaaagatgtttttccaacgcccgaatctccgagaatgatcactttgagcagcgccttctttctggttcccgacatttttgttcactggaagcctttttgttgtgctgcaaaaatcaattaactgataagaaaatgaattatagattaaaaaaagaaagaaaaagatacagacaggcgattgttcaacctgtgtcgcaagaac