Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:143-h6   

Cenix:143-h6RNAiCenix:143-h6
PCR_productcenix:143-h6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W01B6.9 Source_evidenceePCR966WS150 Sequence/Annotation Release
Chunk_score Abs_score861
Max_abs_score861W01B6.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1008654210087731
Overlaps_transcript W01B6.9.1 Source_evidenceePCR966WS150 Sequence/Annotation Release
W01B6.9.2 Source_evidenceePCR966WS150 Sequence/Annotation Release
WB_DNA_textTH:143-h61190ttgaagaggaggtgtcccagatattcaaaggtcttggatacccgtatccactcaaaaacagctactaccaaccaatgggatcttctcatggatatccacatcttcttgacgcactttcttggcttattgatatcattagagttagtaactgatttttttattattttcatccctatttatttaaccatttagatcaattctgctgtcagtgaggacacacaaaatatcctgttcggtgatttcatggaacagggaaaagctcaagaaaaaacgctcaattatgcatggatgacaagtacattcagagattatacaaatgatcgaaaagcagcagaaaatcccagttcttcatactgggacgacacgaagcatcgtctacggaagtatttcgagcaatccaatgaattcgaggatatgactaaaacagctgcatcagctctggagatgctcaattacgaatgtgatgagatagaggctgatgtaagtagaatttcgatacttttgttttaaagaagttttattttcagaaaggaaacgaagcaagcttaaaagaagagatatcaagaatcagagacgacatccgaaaagctaaagattatctcgagcaaaatcttcatgttaagcagcatatggagaaagaactggctatggtgaagtcggagcaagaggagaaaatttcagaaaatgaaaaagtgcaaaagatggtggacgatctgaagaacaaaattgagttgcaaaaacaaattcacggattgacaggaaaagaagtgcgtcaaatgaatcttgacaataataaagacaaggaggtggtactggaaattcaaagcgagttggatcgtctatcaaaagaaacatggaaactcaaagatgaagacttcttcaaagaggtattctaggtttttggaaagttgaatgcctatcattcacggaaatacttgtatgacaatcaaatttgtatgtttcagcaaaagtccaaattcattcatctcgcagaacaaatcatgaaaattctcagtggacttaatattcaaatgaatcttgaaccactaagagctccaacgaatgaaaggtaaatttctaacaatttattaaaaattcacaaatctacattttcagagatcttaaggattactgggagacgttgaacaagatatgggttccagagatcagccgacagttgcatcagagaa