Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:144-d5   

Cenix:144-d5RNAiCenix:144-d5
PCR_productcenix:144-d5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48G8AL.8b Source_evidenceePCR451WS150 Sequence/Annotation Release
Overlaps_Gene Y48G8AL.7 Source_evidenceePCR107WS150 Sequence/Annotation Release
Chunk_score Abs_score107
Specificity_index0.173
Rel_score0.21
Map_statusBottom50_percentile_ePCRI11566281157677
Y48G8AL.8 Source_evidenceePCR573WS150 Sequence/Annotation Release
Chunk_score Abs_score510
Max_abs_score510Y48G8AL.8
Specificity_index0.827
Rel_score1
Map_statusBest_ePCRI11566281157677
Overlaps_transcript (5)
WB_DNA_textTH:144-d51050ggaaaacagcaccaagtcgtgcaaggctcgcggatccgatctccgcgttcacttcaagaacacccacgaggccgccatggctctccgtggcatgccactcagacgcgcccaggctttcctcaaccacgttaaggagcacaaggaaatcgttccattcagacgtttccacggaggaatcggccgtgccgctcaaaccaagcaatggaacaccacccaggggagatggccagtcaagtccgctgacttcctcctcgatctcttgaagtgagtttcacacctattttctcaactcaatttaaaaaaatttttgttaagtgaaagataaaaaattgtttatttttccaggaacgctgagagcaacgccgagtacaaggggctcgatgttgaccacctcgttattgagcacatcaacgttcaacgcgctgccaagctccgcagaagaacataccgtgcccacggaagaatcaaccgtaagttgatttccgctctttgaagcaaatttttctttgtgtgcccaaaactacacgcaagtcttagcggtcggttttctgcggcaatttactttgaaatctccgtagaatattgtgcatatttgaaaacttcaaaattttttaaaaagttttctcgctttaaataaattaatttcagcatacatgtcttccccatgccacatcgaggtcatcttggccgagaaggaggatgttgtctccaagccaaccgatgatgccgcaccaaaagtcaagaaggagtcgaagagaaagcaacgccgccagttggcccgtggagaattctaagtaaactcttgttgataaatgttttgtttgttcgcaagtgtttcccgttacacaaaatacacgaaacagtattcttcagctttaaacgtatctcggtaatcaagaaagtcggtcgtaaatactagtaatttttaatagaaatattaaacagatgctgccagtgaaaaaagccgtgtctcgcgcagcactgatcctcggccgtgcggtggctccagccgagcagctagcaatgattaaaaattcaagcgcagatcgt