Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:145-e8   

Cenix:145-e8RNAiCenix:145-e8
PCR_productcenix:145-e8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS B0348.6b Source_evidenceePCR521WS150 Sequence/Annotation Release
B0348.6c Source_evidenceePCR518WS150 Sequence/Annotation Release
Overlaps_Gene B0348.6 Source_evidenceePCR525WS150 Sequence/Annotation Release
Chunk_score Abs_score462
Max_abs_score462B0348.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV70468075
Overlaps_transcript B0348.6c Source_evidenceePCR522WS150 Sequence/Annotation Release
B0348.6a.1 Source_evidenceePCR516WS150 Sequence/Annotation Release
B0348.6a.2 Source_evidenceePCR516WS150 Sequence/Annotation Release
B0348.6b Source_evidenceePCR525WS150 Sequence/Annotation Release
WB_DNA_textTH:145-e81030ttgacatcatcgcgagtagcatcacgagtccacaaggaaaccttgtcacccttttgacgaacattcacgacagctccgcagatgtagtctccgtactcgtcgaattgctctccaacaatagccatcaacagctccaaccagtagtgatcgagcaattgcgttcttctctgaagcttctatgattcattgaataaaatatatttctcaaaacgtacttgcttatcgacaacaaccaaccaacgtccaccttgaacgttgttgacgtcctcccacattggcttgattccttccttgaacaagtaataatcggatccccagttcaatcctccggcagactgaatgtgattgtacagcgaccagaagtcctcgacagtgtcgaaaagtgaaaccatctggaaaaaatcgataaaagacgtatttaaaaatcttctaccttcagacaatcctcccattccttgttacggtcagctttcaagtaccagagagcccagcgattctggagggggtgtctggtgagaagctctggaggaactgaagcatcggacgcattcacatcgccggaagctgacaatgctttgttttccgctacggatgtgctcatttagctgaaaataggtaatattatatacgattagagctcggaaaacgataaaatagagaagagtatgaatttggttcaaataactcggattttataggaaattttgttttactgcacattttcggctagtttccaagctttttagatttttcaagtgtaattggtaacatcgggcacaataaattgatattaaagcttggaaaacaataaaacaaagtagaaaatgaattcagctcaacttcgacgaaaaatcatcaaatgattcgtttcccatgaaattcctagtagtttttaaacattctagctgttttttaatcgtaaaagtgaaaaaaaaaagagcgatttccccgaaaaaccttggaaaatgaagaaatggaaagaaaggcgcgaatcctgaaattcaaacaccagacacacgcaaaacgagtg