Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:146-a2   

Cenix:146-a2RNAiCenix:146-a2
PCR_productcenix:146-a2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC18E3.9 Source_evidenceePCR523WS150 Sequence/Annotation Release
Overlaps_Gene C18E3.9 Source_evidenceePCR586WS150 Sequence/Annotation Release
Chunk_score Abs_score481
Max_abs_score481C18E3.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42149484215783
Overlaps_transcriptC18E3.9 Source_evidenceePCR586WS150 Sequence/Annotation Release
WB_DNA_textTH:146-a2836caggctccgatattacccaacgtcttttagtggttgatggctggctgtctgtaatttcaacatttaaagcactgatttttctaagaattgattaccatctataaatatttgatcggacgatggactggcacccggtgattgtgaagaatctgttattatttctgttggagcacatcgaacttttcgatttagaacgtacttacttcctgaaaaatctgtattagcttattattaaaaaacttgcaacaaactgtcatattcgtttctagatggttgcgatgcatcgcttccggcatatatttcagcgtccgcgtaatcactctgcttcttttccggaaaagtgtgatatttatcatcaattttttcgcttggaattttcagcttgttctgtaattttatattataaggaaaacggacaaaacgtgaggtttttacccttagcagcaagtttttcttgttaatttcctctcgaaaatcaatccatgattgcagtgtttgctcagaaactgaattaattatagattcttgcattgctctgttctccgggtcggtcgagcttcccaattcgtgtgggcccaggttccatgattttggcggatttctcgttcgagaataactatgtgaattatctgaacaatttcaataattatttttttgtatttttcaagagtagtcttaaagaactcacttgtggaatagtagtgaaagccgtgatgatacatcggaattagagaaaaaaaattatacgttataaacaaaactgaatgaatagaaaagcttaaagggcgcgcacgtggttatttgaaagcgaaatgccatcgacaaaaatctcccgt