Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:146-g6   

Cenix:146-g6RNAiCenix:146-g6
PCR_productcenix:146-g6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C43E11.6a Source_evidenceePCR542WS150 Sequence/Annotation Release
C43E11.6b Source_evidenceePCR370WS150 Sequence/Annotation Release
Overlaps_Gene C43E11.6 Source_evidenceePCR542WS150 Sequence/Annotation Release
Chunk_score Abs_score481
Max_abs_score481C43E11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42325334233730
Overlaps_transcript (7)
WB_DNA_textTH:146-g61198gaatggagtgaagcacacgacatacgccgtcgtcaaaacaccaaaggaaacagaacttgaaacaacatcagaaaacagaggactcatggaaacacggaggggtctgagtccagagaggcctgacgtggatttaacgaatcgaaaggtctcgttcagcactgcacctattccggtaagatcacccacttttcccattcactcatgtttctttgttgttgcaagtttgctctatggaatgtatgatgttcaaaataattttatactttttctaggccaagacagattgaaacgtggccgagaaaaatctttttgaaactatcaatagagcaaacatgcattcactgaaacttgaccaccacaacctaacatttccttttgtttacatatatgtggcaaggtgatattaattcattaatagatatatctatacaatctcgaattaggtcaccttattgatatgataagagatgaggaacaagagaaaaagagaaagagaaagcgatcttcatttgcataatatctaaacgttttcactttcaggtcttctcggcgttttccgttgaagactacgatcgcaagaatgaagacattgatccggtggcaagttgtgctgaatatgaattggagagacgacttgaaagaatggatttgtttgaagttgatttggaaaagggtgccgagggacttggagtctctattattggttagtgattgtattgtggcttaccataacttagaagccttgtatctcggttacaatcggatgttgctcacagtttctgtttcatttttatagttggaaactttcttttctcggcataaccaaagataaccgagatataagcgcttaattaaacttgaaggaatgtcaacctgaagctactgtttaggaaaaaattatatgctttctgcctgcctacggttttcggataaattcgttatgtttcaggtatgggtgttggtgcagactcgggtcttgaaaagctgggaatctttgtaaagagcatcacacctggcggagctgttcatcgagatggacgaattcgtgtctgcgatcaaattgtttcagtcgatggaaagagtttggtcggtgtctcacagttgtatgctgcaaacacgttgagatccaccagcaatcgagtcactttcacaattggttggttttttttggagtattgtgccgaacgcgtatgatata