Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:147-d10   

Cenix:147-d10RNAiCenix:147-d10
PCR_productcenix:147-d10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35E12.8 Source_evidenceePCR575WS150 Sequence/Annotation Release
Overlaps_Gene F35E12.8 Source_evidenceePCR575WS150 Sequence/Annotation Release
Chunk_score Abs_score491
Max_abs_score491F35E12.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1375299413754182
Overlaps_transcriptF35E12.8 Source_evidenceePCR575WS150 Sequence/Annotation Release
WB_DNA_textTH:147-d101189acacaagaacgtgaacgcacttgacgtgaatggtatacctttcactttgaagtttttaggaactgttacatttttggagaatgcaacaaatgtgtactcttcgaacgaagaaagcgctgaaattgagtaaggtaattgtgtttttttaatgtattttccaagttctaaatatgcttacatttgaaatcatttgccaatgcgtaggaattacttgttggcccataatagttaaccaatgtagtcgaatttccacttgatttcatgagcgtcggagaattcacgtaatcatacaagttgcccacgaatcgcgagttaacattgggaccgtcataaacataaattaattttataactatatcagtttttccaatttgatcaactagagccacatttatgacaacattatcgttggtgggagactcaagtgtgtatgtttgtgtaggttgaaggttgagattaagaggagttccggttggcagcgtaggattttgttcaaacaaagcaactgaatatgattaatgattataagtaagtttgaatcaaagatcgtacggttttgataatcataactgaaccaaaattcagacgttgcagttgaggtgtcgattgagacagtagctgctgttgccggagcaaagaaggtaccagaaccttgattgtaactgaaaaatatttgagagtttccaatttattaactttcctcataatacccttctcaattttaaatttctaaaaacatctctaagaacagaaaaatcaaacaatgttaggtttcgtgcatgccaacatgcctactaggcctatttaattggtttaccagtactttatgactgattgccaactgaagctactgcactgcatgcttacctacatgcctacttcaagtaaacttgcctacgtgcctacctatgcgaaataaatatttcaaaataggttgggaaacaattatgataggtgcaaattgagtttccactttttgtgaattaagaaaaactgtgaatcaaaaaattcaaaacatattttagaaagttatctcaatttagcactataggagcggttttaaactattttccaattggcgattcagcgtagtaaaatgcgtttttaatcgaaaatagtcagaaactcatgagctctatgtatttggatgtttttacagtttcttacgcgtaagacgatccgagcacgt