Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:148-a12   

Cenix:148-a12RNAiCenix:148-a12
PCR_productcenix:148-a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07H8.3 Source_evidenceePCR512WS150 Sequence/Annotation Release
Overlaps_Gene K07H8.3 Source_evidenceePCR516WS150 Sequence/Annotation Release
Chunk_score Abs_score453
Max_abs_score453K07H8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV82901058291245
Overlaps_transcriptK07H8.3 Source_evidenceePCR516WS150 Sequence/Annotation Release
WB_DNA_textTH:148-a121141tctacggtgtattgcccctcggcgaattcgagttataacttttttacaagctcgtatattgcaaatcctccattaatctctatttttttctccttttgcattcgcttccgaattttttgtgccgtttactcaactgctctatctttgcagcaggatgaacattcgttgtgctcgcgtggacgatttgatgagcatgcaaaatgcgaatcttatgtgccttccagagaattatcaaatgaaatactacttctatcacgctctttcttggccgcagctctcttatattgctgaagatcacaaggtattttttattctcatgcaaatcttgacttgaaacatttattgttgttcagggaaatgttgttggatatgttctcgccaaaatggaagaagacccaggagaggagccacatggtcatatcacctctttggccgtcaaaagatcttacagacgtctgggattggctaataaaatgatggatcagaccgcaagagccatggtcgaaacctacaacgctaaatacgtatcgcttcatgttcgtgtatcaaaccgagccgcattgaatctatacaagaacacactgaaattcgaaattgtggatacagagccaaagtaagtattaatttgaataaatcctcatttctcggcgcggattagttcgtccctcgatgaacaactgaaaaaattctaatcgacgtttcccaatcacccgttcgatttccaacgttatactttttacagaagtgatggaattaaataattttgtattcttttttggttcacctatttttaatttttgttccaagtcaagttcaaattgaaaaaggttattgtgattatcagtgaaaggacaaaatgtttcgaaaaataattacgtttaataacgtggcgcttttttaaaacaataaacaaaaatatgcgagcgaggtgattaaactttggcatcaatcagaagaaacatacttcaatttgcaaattatgataacttttagaaccttattaaccctaattattaacaaaaatgacaaattccagatattacgcggatggagaagatgcatacgctatgcgtcgcgatctcgcaaaatgggcagaagaacggaacatcgagccagcagatcgagaggcctataccactgc