Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:148-b7   

Cenix:148-b7RNAiCenix:148-b7
PCR_productcenix:148-b7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F57B10.1 Source_evidenceePCR1026WS150 Sequence/Annotation Release
Chunk_score Abs_score963
Max_abs_score963F57B10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65831526584346
Overlaps_transcript F57B10.1.1 Source_evidenceePCR1026WS150 Sequence/Annotation Release
F57B10.1.2 Source_evidenceePCR1026WS150 Sequence/Annotation Release
WB_DNA_textTH:148-b71195attggaagatcgtgtctccgagtccaccaaagaaaaccaggcactgaaacaacagattgagagattaagcagcgagaatcagtcagtaatatcccaactcaaaaaacttcaagctcaacttggacaaaatgcaaagagaactactcaagcaggaagatgtcttgctgtgtttatgctctctgcctgtctgctagtctctccacaactgagtccattggttagttggaaatttcagggcatatgaacaagtttcattattatttaaatttctagggaaaccaggacaatcagaaagtattggaatgcattgaagaagcttgtcagccatctgcaacttccatgaactctgcgaattcagctcaacgagcaatcgccggcgttaccgccccatccgtagtcatcccatctggtggaccagtaatggtttctaccaacgccaatcgccaaatgaatcggaatgctgttctcaatcatcacaacaatagcaaatatcccgcatctggaaatcaaaaccatcatcctatagccctcgaagatttgaaccatccaccacctacactgcaaccaaaacaatcataccaacaacaacatcaaccatcgatgtatcgtcgaagtgacgagacaattgcaatggcaatggccaagattggagcgcggaaaggctcgtcgacatcatcatcgtcggcttcttcggttgcatcgtcgacatcgacatcatctgcaacatctcccatctaccgtacctcgcgtactttgggtgcattcgaagatcaatgcgatgcgtcgtcggatgattcgaactgtgcaaatatgccatcactggtgccaatgaagatgtcagctcagccaccaaaaagaaagattgttacgatgaatggacagccaagagtcacttatagagctgttccagcttcttctgtgaatgtagagcaggcacaatattacaaggtgccacaacaaaaggtgcaatatgtaacgatggatagaccaattaaatatgaagtggtgagtatttaattttaaaaagttggttaatgttttatcgttaattatttcaactatcagttaaatgtcaaaagaaaaacacaattcttcatcagaatttaaatttcctttagttgcagttgaacgactatatcaaaatggaagaagaatcaacaattcgtcttccaaactcctggtctactgctggtcc