Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:148-c6   

Cenix:148-c6RNAiCenix:148-c6
PCR_productcenix:148-c6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56A3.3b Source_evidenceePCR1039WS150 Sequence/Annotation Release
Overlaps_Gene F56A3.3 Source_evidenceePCR1039WS150 Sequence/Annotation Release
Chunk_score Abs_score955
Max_abs_score955F56A3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI51772145178408
Overlaps_transcript F56A3.3b Source_evidenceePCR1039WS150 Sequence/Annotation Release
F56A3.3a.1 Source_evidenceePCR1039WS150 Sequence/Annotation Release
F56A3.3a.2 Source_evidenceePCR1039WS150 Sequence/Annotation Release
WB_DNA_textTH:148-c61195attgtcgttcccacagcttctgcaattcatcgtttctacgcgagactccactccaaaggccatgatgtttgttctcaaaaatttccataatcgaatgagaataattattttcagacgttctcaattcttgcaagaattaaagaagatgacgatttccgccgattcagaacatctcactccctttcaacaccagggcgcccgattcgtgcaagtgttacacatcatccttcaagaaatacggtataaaaatggaaattgattacaacctatatttcgaattttgaattcagatttcttactgtaccgctgaagggcagttggtcattgtcacattgggatcatacacggaatccagtgataaacacgaagaattcacaatgggagaagttggtcttctgggaaaacttctaggtggcactgataaacgagtcagtgatgcatgtgttatgaagaatcttcgcccgacttctggagtcacgagagagcgaaaaatttcagtccaatccgatattgtgttcgctgttaccagagacggatgggtgcaagcatggaatgttgagacgaaaaaacaattgccaagcactattgacttgaataactactttgcttcagacggaaaatctttgaatcgagatctagaatctgcagacttcgaggaagaaaagtctccaatggaaccaactgaaactgtatattctatcagagcttattcattcgatgtggatattcttctgattgttggatgtgatttggcagtttcgggaaaaagcgtcgggatgagagttcatattctcaaagtttcaaatgatcaaattcaacatctacaaatgttcgaaacatcgatgtccgttgatgaacgacttgttgatctcgagcttattcaaaactatttcccatcaaaggaatcggaaagtcttgatgagacacaagatgggtaagaatcgttgttataaaatgggtttttttcttgtctaaatataaaattgtttcagggaattgtataatcctctcacagctgcactattttcactttctgctcttttcaaaagttcatctgcaaagaaaacctattcgatgaaacggatctcatttgctatccaatggaaaaagggacgagttttcacagatttcgattggcattccgttcgtcagttcacttcgcctgccactaccaaagaagaaccgatcggcaata