Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:148-f4   

Cenix:148-f4RNAiCenix:148-f4
PCR_productcenix:148-f4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F54C9.6 Source_evidenceePCR946WS150 Sequence/Annotation Release
Chunk_score Abs_score883
Max_abs_score883F54C9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII85711168572315
Overlaps_transcript (5)
WB_DNA_textTH:148-f41200tattttaatgcgggagctggtctagcgggaataggaatagcaatgagctttctgcggaggacagctcaaatcagcaacacgtattttcgtaggcgttttatgatcaatcttcaaattaataacgaagacgcgtaagttatttacagaaatccatcagaaaatataatgattttagagcgtatccatggcttctcgatttcattaataatcgaagtgctacccaaacacggaatttatcagcgaatacagttgttcatcaagctgaaagtggcaaaactgaattatcaatatcattcctacctggccatggaactcattttttcgtccatgattatcgatggatcaaagtcgaaaggcagcgtgaaaagcaagttatccagcgagacggaattcgtacaccatttgaaactgtcacattgactacgttaggctcagatgtgaagtttttcaaacggatgctcgaacaatctgcaaaagaagccattgataacgctgaaacgggtcttgtcatctatcaagctgttggtccacaatggattcgatttggtgttccgaggaaaaagagagacattgaatcagttattcttgatgggagaatctgtgaagagctggttgaagatttccaagaatttattagttcggcgacatggtatgcggatcgaggagtaccttatcgtagaggatatttgttttatggaccacctggaactggaaaaagtagttttatttccgcattagcgagtcattttggatacagtgtgtgtttattgtctctaagtgaaaggacacttgatgatgacaggttagtaatatttttaaaaacaacttagttcttttttggagaataataacaaaaatttagagaataaaaacaattttgtagttaaatagatatatttggtgatacggttgatattttaataatttaaatcaaaatacccacagatggtactctaaatttttagtaaatagtttgtgaaaatacagtcttttcaatgtgatcttatttcagactgaaccatctattgaatacagcaccaccaaatagtgttgtgatcctggaggacattgacgcagcattcgtcagtcgagaagatcccatgtccaatcatcctgcatatcaaggtctatccagagtcactttttctggtcttctaaacgcattagatggtgtcgcttgtgctgaagagcgactcacat