Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:148-f9   

Cenix:148-f9RNAiCenix:148-f9
PCR_productcenix:148-f9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS H39E23.1a Source_evidenceePCR804WS150 Sequence/Annotation Release
H39E23.1b Source_evidenceePCR804WS150 Sequence/Annotation Release
Overlaps_Gene H39E23.1 Source_evidenceePCR804WS150 Sequence/Annotation Release
Chunk_score Abs_score764
Max_abs_score764H39E23.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1412525814126456
Overlaps_transcript H39E23.1a Source_evidenceePCR804WS150 Sequence/Annotation Release
H39E23.1b Source_evidenceePCR804WS150 Sequence/Annotation Release
WB_DNA_textTH:148-f91199ggagcgcacttgcaaattatattttttttcaatattcattttttcattacaattcgcctaagagaattactttgaaaattgaatttaattaggtgaaaaattgaacttttttccaaattccagcttcaatttaaaattttaaaaaattgcaaaactttttgaaaaaaataatcataaaacagtttttaaacgtttttaattattattttttttcaatttcctcttccaaacaatgaatatcgtgagaaaaatcagatttttgccttaaaatacaatttttaattttttccaatgttttacaatgattttcgtcataaaaactcacctgaatcaatttctcaattctctgttcatcaatttgatcttttggtggctcaataaatggcttaagctcatcatcttcatatcccacattcatccatcgatctttcataatattatccaatgatgatctcctttgtggattgataacaaggaatttcttcaacaaattctcacaatccgttgacatatagaacgggatacggtattttccacggagcacacgttctcgaagctctttcaaattttgtccatcaaatggtagacttccggatacaagagtatagagaattacaccaagactccaaacatctacttcaggaccatcgtactttttaccggaaaataattctggagcagcgtacggtggagatccacaaaatgtgtcgagtttgtttccaagtgagaaggtattcgaaaatccaaaatcagcaattttaatattcatatcttgatcgagaagcaaattttcagctttcaaatctcgatgaattatatttttcgaatgcaaatattgaacagcagagacaatttgtcgaaatttggctcttgcttctttctctttcattcttccgtgtgcaaccaaataatcaaatacttcaccaccggatgcatattcgagtactaaatacagtgtctgttcagtttccatcacttgatataatttcacaatattcggatgatccaattgtttcataattttcacttctcggaacaatttttgaagactcgatgggttcagagcagtcttgtcgataatttttatagcgacttcatgtccggttatcacgtgctttgcgagttttacctgcaaaaataattaattaaatggtcatatatctaagatttatttttgtcaggctgtttcgtatttccga