Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:148-h10   

Cenix:148-h10RNAiCenix:148-h10
PCR_productcenix:148-h10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.11 Source_evidenceePCR258WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.11 Source_evidenceePCR391WS150 Sequence/Annotation Release
Chunk_score Abs_score307
Max_abs_score307K04G2.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80394168040439
Overlaps_transcriptK04G2.11 Source_evidenceePCR391WS150 Sequence/Annotation Release
WB_DNA_textTH:148-h101024cgagtttgtcgctttcgtttcatttttttgtgaaaaattgttttaaatcagttaagcaagcaggtcaaaatcgtgtgaaatttcaataaccgatttgaaaacgcttctgaaatttaaaattaggttactcatttagcaggatgaaactgtagtcaataaagtttagtaaaaaaaaaacacggaaaatattagcttagtaaactgaataataataatacacaaaggggaatatgggtgatctgggaaaaacagcacggcacaaacgacaaaacctgataaaaagacgcaacggctagtggaaatggcgcttctagacacgctgcgaaacatccaattacagcgatctgacacgttctcggtgaaggtatttatgtaaaactattgaaaagatatggttaaattggaattgaaaccaaacttgtgaggaatataaaaaatagactttaaaaactgaaaagtagtcaaatactttattttacaagatggttgattcacggcaagagggaagattgatcgatgtgaaacagcttgcatgaatcgtgtattttccagttcttcacgatgtcctcggtttctctctaaaaatttttgtataaattaattttttctggaaactttcaaaacctcaaatccactgaaatcgataactccgacaacagcaacgtatggaaatttgttcataattcgagacaattcctttctcgttaacacctcgatcatcggtattcctgcgagaggacagacaatttgtagagaatggaaattcgaagcagctgaattattaaatatgtttattgccacgaaaaataaagaataaatacctcttaaattattctcgtccatatttttcgcgtagaagatgagctttactcttccagactgtgcaaactttagtgtttcgtgagctccacatattactcgtctcttcagaaagttctgaaatcacataaaatcactaatacgaaaaattgcgaaatttcataccttttcatccgcatttcctttgcgattcttgtcttgttgg