Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:149-b6   

Cenix:149-b6RNAiCenix:149-b6
PCR_productcenix:149-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01C3.11 Source_evidenceePCR347WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcript T01C3.6.2 Source_evidenceePCR481WS150 Sequence/Annotation Release
T01C3.11 Source_evidenceePCR347WS150 Sequence/Annotation Release
T01C3.6.1 Source_evidenceePCR532WS150 Sequence/Annotation Release
WB_DNA_textTH:149-b61066ctgccatcattattccagcctgcctgattccatgtttagtatcaaacactgaagcatccttaaaagtctacacgcaggaatgcatatcaaaggtttgaaatgtttagctcatcctgaaaaaattctgccaatatttcaggcagactattcgtcatgtgaaatgttcaactcatgttgtgattttcgatgtagtcgtgctcggcagaagagatcaacgtgtacaataaacggaacgggaatcagcgaagttcaaactgagtgcatttggtgagtgtttctataccataccagaataagattgaattttaagctctaaaccaatacaacaattcgaagttgcctacacgagaaaaactaaacactcaagattggacctcatcgccggaatactattcatttttgtccttgatatgcttttgctcagcttcactttctaaatctttttaaattcgatctcataaatcttttttttcaataacaattttattgtgcaacaaaaagaatttaacggtaagacttctggtagcgagcgcgggctcctggtccaccgaacttcttggactcacggcgtcttgggtcagcaaccaaaagggacttgtcgtaagcggcgaagatgttcttcaattctctcttgctctgctcgtcaacgtacttgtggtagtaggcaacgagagccttggcaagggcttgacggacagcgtagatctgggcaacgtgtcctccaccgctaacacggattctgatgtcgacatcctggaagcgttcctttccgacgaggagaagtggctcctgaaaaatacaagttagttggaatttaatgtcggaacaaaaacctgaagcttgatgcgcaggatctgtggctccaagaactcaagtgggcgaccgttgaccttgataagtccttgtccctttttgcagtgagcgacagcggtggcagtcttcttgcgcccgaaggtctgaaccgattgcacggtagacgtcattaccctgtaataatatattaaacaaagaacaaaataaaggttacaattaaagtagaatagaaatatcggcaaggttgagaacc