Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:15-c10   

Cenix:15-c10RNAiCenix:15-c10
PCR_productcenix:15-c10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34G6.5 Source_evidenceePCR1109WS150 Sequence/Annotation Release
Overlaps_Gene C34G6.5 Source_evidenceePCR1172WS150 Sequence/Annotation Release
Chunk_score Abs_score1025
Max_abs_score1025C34G6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58725025874198
C34G6.6 Source_evidenceePCR7WS150 Sequence/Annotation Release
Overlaps_transcript C34G6.6a.1 Source_evidenceePCR7WS150 Sequence/Annotation Release
C34G6.5 Source_evidenceePCR1172WS150 Sequence/Annotation Release
WB_DNA_textTH:15-c101697tcagtgcaacatgcagaacaactcaagagaaacgagcaataaaagcaattcgaagaattgaaaaaatgagcatgttatcaattgaattggaattactatcagaactcggaggacacttcaacattgtcaaacttttcgaattcttccatttcaatggttcagttgcaattgttctcgaacattttccacattgtacagccacagaactcttatttcattcaaaacgagatctttcatttgctctctcttattttcgaaatttgctttatgctgtcgcatatcttcatcacaatggatatgtgcatcgagatatcaaattgtcaaattttctctactcaccccaaactcaaaggtttcagattaatagttaaagctcctcagcaattattttttccagattccggctcgtagattttggactcgcaacagttgatagatcaaaaaatgaatgctcaagagtgagtttcaccttttaacttcaaaattaaattttccaaatcattgaattaatttcagagtcatgctgtcgctgcaatggaaagagatccagaatgttgttcttgtaaaggtacatcgtcaccgtgtatgttttgtagaggaaaaccaaagcgagagaattataatgttgtaagtaatgaaatcttgtttttttcgatcacataaatattcaggttggaactccaggtgttcgtgctccagaacttttgtttgggattggtttgtgtcatccatcaatagatatattttcctgtggaattgttctcctttcacttgtttctgtaaaacatccattctttatgccaaaagatgaaactgaaaatattatgcatctcgctttcttactcggatctgaaactatcgaaaaagtaagtaatcaaaagttgacacaagaaaaaataactcgatccttccgaaaaaatatttggagcaaaatctaaatatttaaaacactttctcaaaatcagttgttcaaatcgtcgaaaatttttcaatttttttctgttttgggaaacattaaaaaaaatacagaagagatttgatgaacagctatgaaaagttagttaaaaataaataatttatggaaaatttgaagtttaaaagtgagcttactcaccttatagaaaaattccagcttaaactcaaaaattattttcagatggctcatagtgaaggactacgagtgacattatctgaaaaacttcctcccgcagattactatcatctaatattatgccttcgatttggtttcgatcatgttcgacgacactgttcttcgtcaagacaaccatgtacaatatgccaaaaacgttcgttcaataattcgatgggagtgtgcttttgtgagtcatcatattcatttcaaaagtgacaaattgctttcaggccgaaaaaactacgaaacagacatgttttctactggtggaaatgaaacagaattaatgacaatatacgtggatctgttataccgtacacttgaggtgaagaagtcttggaatttaaaatacattaatttattcttacaggctgatagattcaagcgatacaacgccgatcaactgctctgcctcattgaatcttacgataaacgtgtgaaattcaaaccgaaaccaatgtcgaatcaagatccattctaaattaaaatgccatcaaatacttacattactcttactccgaatttttctcgcttgctgtgttgt