Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:150-d1   

Cenix:150-d1RNAiCenix:150-d1
PCR_productcenix:150-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05G11.7 Source_evidenceePCR428WS150 Sequence/Annotation Release
Overlaps_Gene T05G11.7 Source_evidenceePCR428WS150 Sequence/Annotation Release
Chunk_score Abs_score386
Max_abs_score386T05G11.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1594546415946581
Overlaps_transcriptT05G11.7 Source_evidenceePCR428WS150 Sequence/Annotation Release
WB_DNA_textTH:150-d11118agttccaattggctgactcgcagtgtattataattatttttgaaagtccgggagatatacaatttgtgcacggcaacatttatttactacatttatacaaattatacaaatttatacaaatacaactaaattgtctatcaataaattatgattagcatttggccaaatcacaattaatctctgtcacaactctacttttgaaaattgtaaatttttacatttttcagtatttttcccattgacaatattttttcgaagctgaaaatttaacattaaaaaattgttaccggaaaagtgaaaaaaacaagattcagtttttttctgagaaattaatttttctaatttcactctttctcttcgccgctccaagtctttaaccaaatgttctttgttttctttttttttggttgttttgtccaggtttaagatgccagaaaagtggtatatgcacattttgctttattaacacaacttaacaaataaaacttattaaattagttagtgtgatgttttgtgcaatattaaatcatttttagataacttgtaatgtccgatgaaggcttaccgttttggtatactgtgtgtttaatactggatgaaataactcactatcaacagctttatctggaacctattctttccattattggcttttttgcgaacattgtccatttgctgattctaatcagaaaaccgttgagaatattcacaatatacctattcctgatgggaatttcaatttgtgatctttgtagattgacttcttgtattatcgaatcactgcggttttattatgattcctatcaactatcaatattggctgaaaagtggtaaatgttctgcataatcttataaaaaatctgaattaaaaaatagcattacagtatacccccaagatcatatttactatcttttattctactttactctgatgcattatcgaaaatttctcagaagttatcagtgtggcttggcgtcactatggcaatgttaagatttcttgcagtaaaatatccaatgaatcgaaggtaaggtgctacaattttagagtcaccgagtgtgcaactttatttttcaacaaacttgtttgtatttttctgccccattgaaaactgaat