Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:150-e2   

Cenix:150-e2RNAiCenix:150-e2
PCR_productcenix:150-e2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07H8.5 Source_evidenceePCR629WS150 Sequence/Annotation Release
Overlaps_Gene T07H8.5 (3)
Overlaps_transcriptT07H8.5 Source_evidenceePCR629WS150 Sequence/Annotation Release
WB_DNA_textTH:150-e21466aatgatgagaccaccccaagaatgagggtgtgaagctctagtagaccgtgagaaaggcttcgttattttaaagaatatagacgtaaggtgttcttatttataaaaacatgatttattggaaatatgcttttgaccactttttagacagaaaaggttggcggctgtcggctatggttttgaattgaaataacgagtttattgaagttttatattcaagccttcttcatctgtatcactttcaattgacattttgcattcccttttcagtcttgcaccatacatccacaatttggaaactcttttgttaatgaaatttacaatttatgctctcctttacaactttgaaatgaaacccaaaaaactaatattttgttagttaggaatattttcaaattgccaaaaacgatgttagcttttaagactaaaaaattaatgcagtatgcttgtggaattttgagaatgtgccgacagtgtcatcctctatttcgtaatactctctgaaaagtatttacgatgctattagggcgaaaccactttaatgtgaccatttttgttgtgcgaacttataataccgctatcagttctgttgttaacaccttgcatacttcctcagggcgaggcggacgttttcatatttgattactcacccgtttgctgaaaataatcaaaacatagggagttgacaaagagagcaagtcgtttgcaaatgggcttaatagttgggcaattcggctgctcaataatagtttcgatgggtcaatgtccgctgatattttgtttagcatctgaagttttcgttttgagtttaagaaagtgataatatttcaatgactgtaaacctattctaaagtgtaacatgaaaatactccgtaaattgatcttcaaaaaactttgttaagtttggcttttatcatcacttacagcaatagaaaatactccgcagttgatcacaaatgttacaaaggataccagaaaaagacgataatcgctttgttgacgagccgctttgctatattttgatattttgaaccagcaaattatattggcaattatgctgagaagcaccgtaactaccatccaaacaagtatgaatgaatataaaaacggaagatctgcttgagttcttgccacatatgtgtctgataatggattgtattctaagtaagcttgatgaacaagtaatggatatgtaaacaaaatgggtgtaataaaaattaaagctatcagaatatatgtcccatagtgccatatctaaacaaatttaactttccagaaattgaagacccaaatgttctaatgactcacttgaaaatatctctttggcataaaaattaaagtgaaacgattaatagacgtcagaaataaatttgaataactcataaatcccaagtgatattgacagaatataaaaaatttgaatgggaacattgaaccagaatcttttgataaagaatcaaaccagcccg