Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:151-b6   

Cenix:151-b6RNAiCenix:151-b6
PCR_productcenix:151-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY37E3.15b Source_evidenceePCR264WS150 Sequence/Annotation Release
Overlaps_Gene Y37E3.15 Source_evidenceePCR424WS150 Sequence/Annotation Release
Chunk_score Abs_score389
Max_abs_score389Y37E3.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI21020882102818
Overlaps_transcript Y37E3.15a.2 Source_evidenceePCR424WS150 Sequence/Annotation Release
Y37E3.15b Source_evidenceePCR264WS150 Sequence/Annotation Release
Y37E3.15a.1 Source_evidenceePCR424WS150 Sequence/Annotation Release
WB_DNA_textTH:151-b6731tctaatcggaaaaaccccgtgtttcaaaaaattccaaaaaaaaattcaaattttcaggtaggaaccgaagaatcattccaaccagaagacgacagtattgatggaatgcctacatggcaagtgacatatcactgtgtccgtgctggggacatgaaatccgcttctgaaactctaaatcgcctcaaatcattcccacaatgcgccacacttgtcgccgcgttgaatcatgtcgcaaagcacggaaaactggattctgagctgaaaaagaagctgaaagtcgagtggagacacaatttggctcatacaaaagacaagtataaacgagcactctacgcagcactactcggtggtctggactcggctgctttggctgatacactggagaattggatttggtttaagctttatccgttgcatgttgatccacagcttactgatgtactgttcaaagaggttcagaaagcggtttctgttgattatggtacggagaagtgtggcaaagtgatggaaaacccggttttttatggaaaaagtgatggaaaatcaaggttttcatggaaaaaatgatggaaaatcaagtttttcatgaaattttcctactgaaaaagctaaaaaattccggcaattccgacacttgccgcttgacaaaatttcctaaaatttcagcaattgccggttttgtgaatttttgagattcggcaattccggtaattgccggttttcaaaatttc