Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:153-e5   

Cenix:153-e5RNAiCenix:153-e5
PCR_productcenix:153-e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY57G11C.34 Source_evidenceePCR819WS150 Sequence/Annotation Release
Overlaps_Gene Y57G11C.34 Source_evidenceePCR819WS150 Sequence/Annotation Release
Chunk_score Abs_score714
Max_abs_score714Y57G11C.34
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1476670014768137
Overlaps_transcriptY57G11C.34 Source_evidenceePCR819WS150 Sequence/Annotation Release
WB_DNA_textTH:153-e51438tttcggaaaaacggaaagaaataaatcgatattttcaattcaattcaaaagtttaaaaacacaaaaaaaagtaacaaaacaaaagagaaacgataatctaagctaattatagaatgtctagaaaatgaataattaggcacgataatgtgcatatgcccgattcgcttcacaagtcttgtgcaattcctgtttcgcttgaatcgttgatccttcgttttgactggcggcgagaagctcggtcgcgaggatgtctctggaattaaataaattataatttaaaaatagaaattaacccacttgaaatgtgtctctccatgtttcgatcgaactctacaaatatctctcatcattttcattgctcgaaactcggcttctggttcttcaattggaaatggaacctgataggtggttcctcctcgggttacaccttgaagcttcatgagaggatgacaattctgaatttatttttaattaaccagtcaataaaatataaattctcactttaattccctttttcgcaacaagaaatgggtctaattcgatacttttcttctcttcttcggaagcctttgcccatgccttgtactgccggcgcttgatgatttccaacgcgctgagcacattcttgcgagaagtctccttttccccgtcttttgtgcacactcgaattagtttgtcgatctttaaaatagtatttgattttaaaaaaatattcaaagcattgcaagtttaccacatgatctctgtaaaatactggtgtcgcatcacttttcatcgctttgaggaacaaaaagttgcgctcatcatccgaatccaatggttttcggagctaaaataatagttaagatttatagattaaaacaaacaaattaacctcttgaacattcgttacgggatctctgaatactcttggatcgtacatatttgatgtggaagtcgtcgaagaaatccatcgtttttgagcgaatcgcgccagttttgtggtcatatttactacaaataacaatattaagtatttgataattaaattgcaaatcatgaagctttgaaaactgcaaaaatatgcgaagaaaactcggaaatcaatggaaaatccgtggactcgctcgtatttcgacacaagagtgcagtggagcatgcttgcatactctgcgtctcgtctttttgcatagtctatcgtctcaataaactgggcgcgcatgcatttcggagtattgttgctagacatttatcactttttgtttttttcctgttttcatcggcttttttctgaataataataatacagtttaaataaattaaaattcctttttcttatttatgacaccttcctttagcttttaaaataaacctggtttatttcgtgaagagaaatccttttcatgtcataaacgattttatttcttgcttctttttcagtatttccgctcactcagcc