Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:155-c4   

Cenix:155-c4RNAiCenix:155-c4
PCR_productcenix:155-c4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK616.6 Source_evidenceePCR525WS150 Sequence/Annotation Release
Overlaps_Gene ZK616.4 Source_evidenceePCR24WS150 Sequence/Annotation Release
ZK616.6 Source_evidenceePCR692WS150 Sequence/Annotation Release
Chunk_score Abs_score608
Max_abs_score608ZK616.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV53936345394974
Overlaps_transcript ZK616.6 Source_evidenceePCR692WS150 Sequence/Annotation Release
ZK616.4.1 Source_evidenceePCR24WS150 Sequence/Annotation Release
WB_DNA_textTH:155-c41341cggaattcaaaatcctggaataaaaaatagttatgaatctgttacatgtgatctttgttgtatcactgatcactattcccgtgttcctagcttcttcacatgcttcatcattctttgagctctggtaacttattttgcatggcgtgttatcagtgagttgttgaatggtgtgacatgaatttccgagagaaaaactatagaaaataattatgtatttggggactttcgaagtacaatgaaatgggggaacgaagcataatggaaaaaatgatataaattatatactatccttattaattattctgcaatcaaatatggaaaagatcacgcaagtttggaggaaagattgggaatggaaattgactagattcgttcggagattcagatgaatacttcgtcgattattgaatactgagcacgacccggttgaggaatgaattcgagccaatctgatggagtattcggtagaagacccattgtatgtactttatagatggcaagaccgattgctccgaggtttccaaggcagaagatgagcttgtgaataaacattgatccagttgcagggctctgaaaatgttagaatatttttttgtttaacgccttctccaaacaacaaaaactaaaaggtacaaaaaccagtactaattagcttcaaactatagtttgtgggaactcgcaacttacctcaagcggtttgaatgtggaattgactgcgaataatgctttcagcggcctaaacaccatcattccgaccatcataattgggaaaatcgacacaccgcctccggccatatacatcatgaacatgttcatcggcagagatttagctggtcccattgcagtgtcccatactcgttttcgtgccagatgctcgtgttgatcagcggatcgatcggcttcggcctgaaaattgagaaattataaaattaaggttttaataataagcagatttttttctttcttaatgttttttaaatacacaattttagcgaataactgtttttttaagacttttcaattctcgaagaaattcaactcacgctatgttgaacggtggcagctgtcgagtagaagcctggcgggttaaaattactgtccgcagtacgacaattcttcgaagagtaagtgtagtcaagtttccaagccgatagtgacattctggaaaagaattgaatatttaagagcaagaaacaaatggcaatgaaaattaatgaaagagcaaaaatcgataaatacgccaggtggttgctgacgcgttctttgatcgcgttggcgcactctcggtgtcggcataaaatttaaactgatatttttcttccctcggcgtttattgttgtt