Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:155-c7   

Cenix:155-c7RNAiCenix:155-c7
PCR_productcenix:155-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK892.7 Source_evidenceePCR577WS150 Sequence/Annotation Release
Overlaps_Gene ZK892.7 Source_evidenceePCR577WS150 Sequence/Annotation Release
Chunk_score Abs_score535
Max_abs_score535ZK892.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII99809579981918
Overlaps_transcriptZK892.7 Source_evidenceePCR577WS150 Sequence/Annotation Release
WB_DNA_textTH:155-c7962ctcgaaggacatgctggattgtcattccacattttcgctttctgcatccactgattttaggattgggagattccagttctccaacaatctgtgagtagttgtccaaaatgaatttgagttgtgtttccgataaatcattgaatcctccagagtcaactttcagtgattgctgacatttttgctgtcgattggcagagtaggctttggattggagaatagctgcttgtgatagtgttcctgaaaataatttactaagatttaagagtgaataaatttgatattaatactcaagtcttcataactgcctatcgtctttctattttttaccaggcatccttgtgcctactttaaagcttcaactaacctggtgcaaatgtacccttggctagtaccacctcgtctcctggctgcccagttgctttcattgcgtccaaatgagttctcagttgaattttgttctcaaaaatccaatggcaacaactacacgactgtacatctacatatccatgagcatgttgcaagtgcttctttatactttctcccagaatcggagcaccttcacagtttgagacgcagatgagacacgtgtgattcttggtgtgaagtctgtccctatggcgagtcattgagcccgtttgactgaatgtaagttgacagtaaccgcagattggtgcttcagatttaggcgaaaaatatggaggcattttctgaaaaaaaagagatttaggaagaatagtcgtgaaaaaatatacatttttaaagaaaacacacaatctttcgatacagaccgaatgaagagcacactgggttagaggaaaatgtggtgaatgaatgtgtggtcttcgttacatacacaacgtgtcatgatgggtaactaggcggagtccatcgacaacctggcgttccaccaggtttacacccgaccaagtactgcgttcatgtatcaaattgcggttggactc