Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:156-a12   

Cenix:156-a12RNAiCenix:156-a12
PCR_productcenix:156-a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C55A1.13 Chunk_score Abs_score151
Specificity_index0.2
Rel_score0.25
B0391.1 Chunk_score Abs_score605
Max_abs_score605B0391.1
Specificity_index0.8
Rel_score1
Overlaps_pseudogene B0391.1 Source_evidenceePCR595WS150 Sequence/Annotation Release
Map_statusBest_ePCRV1562129215622990
C55A1.13 Source_evidenceePCR312WS150 Sequence/Annotation Release
Map_statusTop50_percentile_ePCRV1562129215622990
WB_DNA_textTH:156-a121699aagcacgcacaagacagatgcagctgcaagagatttgtgaatcaacgatccgtcaactggtgagtaaaataagggccctgtgtaggaaaactcgtccaacgacaaattcttctcattacgcatgaattctctgaaatacttgttacatgcaaattttaatgctaggcattacccagcaagaacatccatttctggagaattgggatacagaaaataagtacccagtgcataggctactccgtaggcaaagggcaatgcaaaccaggtcacgatttcgaagtttttgaattttttgagaatcttgtttccggttgcgacgaaggatcggtaggcaaagacaatgacaaacattcccatggaaaatccaaagaatccgcagtacgtgcctgaaatttgttagttttggtggtgatcaaatctcaaagcaagaacttacagttaaagatcattgaaacgtttttcccgaaaaatcgatctttatgaggaacaactactataaatgatggcccaatgttaaatattgtctggaaaattagaaaattcaaatagtgaaactcctatcagcaagtacttatagttgcccatttggggtggagatcggagaatgataagaaggatcaaaatggagttgaagaaaattgaagtgggtgccgtatagtacggcagagcattctgaatggcgtccattgtgaagaatgtgaagatttccgtctgattttataagatctcaagtctcaagtgtttttgcagacatatggcagacaggaaaacaataacaaaaaagtctcatacagctccgtgacggtgatcacaaattactgtttaacgattaatttatagctattgtctattgtcataacaaaaactgtctgataaaaatgctatttcagtttaagtcagaagaaaatctatataatttcataaagatccttcaaacttagttaggttagtactcaaattatcagcagaagaacactttgaacaagaaaaaagccgatctgagaattttcaataaattttttctctactttggaggcccgtcaactatttatgacttttaaggtttttagagataaacattttattttctgaaacaaaaacctgatcgagttgggtgaaattgataaatgggtaatataaagaaacgagtcgagaagagcctcacaatgaagtcatggcttgcgtgcccagtaagtaaatatttcgtgattcaaatttttgtcgtcattgtattcccactatccacgttctcgggacgccttcgtcgacaacaattgagcaacggcattataaattctgaaattatcaactgattaactcactgataaatataaactcaaatcaattatcgctgatcgatagcttttgacaatcataatggtgggaagtggatccagaacaggaaataatgcgatagttgttgcaactgagaattgattgaacttgatgttcagtgcggaacaggtgtataaaatacatacaggtatatgcattaggacaagtggaaccacggcctgaaacgggaaaagaaaatacgtcccgaatcaaagaggccgtgaaacttttaagatccaaaagaaaaactcacttgaagcacaagtgcgatgaacagttgatgctgtagtttctttattttggctgacctctcattagtgatcttcgtgatttgagagatgtgactgtaacactgaacgccgaa