Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:157-f11   

Cenix:157-f11RNAiCenix:157-f11
PCR_productcenix:157-f11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14C10.6 Source_evidenceePCR454WS150 Sequence/Annotation Release
Overlaps_Gene C14C10.5 Source_evidenceePCR41WS150 Sequence/Annotation Release
C14C10.6 Source_evidenceePCR454WS150 Sequence/Annotation Release
Chunk_score Abs_score411
Max_abs_score411C14C10.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1260985512610518
Overlaps_transcript C14C10.6 Source_evidenceePCR454WS150 Sequence/Annotation Release
C14C10.5 Source_evidenceePCR41WS150 Sequence/Annotation Release
WB_DNA_textTH:157-f11664caaatgaatcactacgccgaataaataaattgagatttggagtatctgatttcgggttaatctaaaaattgtattcgtatagtgcgattcctgaaagattcctgaaatagcagttcaactgaatataaattttaaaattagttttcagaaatggagagaagcaccagagcatggatgtcaatagttgtagttcaagcaatgggaagtgtatggatgtgctatgcaaaacagaattctgcatctcactatacttcaacattgccagctctttctagagctcatgctcttccgttggcattgctttgtatcttgaggtattatttcaatattcaaaaaagttaaaaacaaggaagatttctgttattatttttcagaatcgttctaatcttcgactttcgtaacttctcaattcacattgctcacattctgctctcaatcctcacagccatccatacaatgactgaagtattcttctatcaatctatgtcttatggaattgtcactgtcacagaagtcactctcaacagtttttcagttgttgttatgctaactttcctactctctccatcattcaaaaacgaacaagaaggaaaagaaaaacgagctagaaaagtgacagcaaaacactatatggaaggagaaatgcttactccggaagatgacg