Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:157-g8   

Cenix:157-g8RNAiCenix:157-g8
PCR_productcenix:157-g8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC09G5.6 Source_evidenceePCR1181WS150 Sequence/Annotation Release
Overlaps_Gene C09G5.6 Source_evidenceePCR1244WS150 Sequence/Annotation Release
Chunk_score Abs_score1181
Max_abs_score1181C09G5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1071068410712023
Overlaps_transcriptC09G5.6 Source_evidenceePCR1244WS150 Sequence/Annotation Release
WB_DNA_textTH:157-g81340gtccatgtccaaagcgatcttcgaagtttgattttaatgatgcatacaatgatgatgagaagagaggcctagaggaacatagaccaagaggatacgattcagaacgcgccgaagagccaagaccaagacagactgttcgtactaatacctatgatgaaaattctggagccgaacatcaaagaagaccaaactacgaaccttcagcagaagttgctccaccacgacaggatcgttatgaagacgaagagagagttagagaaccaccaccaaagagaccgccaccaccacaccgacaaactccacacgagttgtacccagaagagcaaccatatgtcagaagaccaccaccaccacaaaacagaggaaattatgaagttgaaagatcaagagaatatgtgccagaagctccaagaccaaggcaaggttatgaacattcatctggatatggaggtgatgacaggaaagagcagccaaaatatatggaaagtcgaccagttgatgagccaagatacgaaactgatgctccatcaagaagtcgcccgctgaagaaggttgagatcatcagacacccagaaagaggatacgatcgtcgtcagccatcttatgaggattcgaagccaagacaagaggagccaagacgatatgaaacggaagctgagccacgctatgaagaagttccacggaaagagacacatcctccaggatttggaagaccaaaatctgaggaaaatccaagggaaacaggaagaacttactcagaagaagcaatgccacctgtgcaacaaactgagaaatataatggagataaaagaaagaagaatcagccagagtatgaggatatttcaaaaccagaagaggataaagaaagagcaatggtaagtgatattgtgatgattatttctataaaagaactataaattgcaggaaaaacaccacaagaagcctaataagttccaagaaaaacaatgggaagagcatagaaagagccaggaactcaggaattcgagagagcatggaggacaagttccaggtagaattgttatgcggaaattatcattaaattaaattcaattgcagttgaaacttccgtaccaatgcaacaagtaaaacctgaatcctctgcagaagaaaagccagttccacctgtacatgacaacttccagtcatccgagaaaagagctttttccaacgaaaacccactaccatcagaacaaattccatacagaaggagaaatcgcttttacaggaaccactattatgagaagtttctagtttaataactaaaaaaaacttctagtctaacttattgttgattttttatttattttcaccccttcccc