Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:158-b5   

Cenix:158-b5RNAiCenix:158-b5
PCR_productcenix:158-b5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25G4.4 Source_evidenceePCR616WS150 Sequence/Annotation Release
Overlaps_Gene C25G4.4 Source_evidenceePCR750WS150 Sequence/Annotation Release
Chunk_score Abs_score666
Max_abs_score666C25G4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1245325912454483
Overlaps_transcriptC25G4.4 Source_evidenceePCR750WS150 Sequence/Annotation Release
WB_DNA_textTH:158-b51225cattatccgcctcttttccagccatctcattttcgatctcatatttaagttgtccggcttcagatgttctcttggacttccgagcttgaagcacctcttcagatggagcattcacataatttctgctttgacactttccactgcatcgattcatatgctcgtagaagtcgatggtcattgcttccatgtgagttctagaatataaagttttgagaaacagaagtattttaagggattattgtcttgatgctcacctcaacgaagatcttccaacacggatgctcgccttccaatctttctgacgctctttgtcgccacggattgtgaactgcttcggagaaagaagatcgtctgaaaataattatattatgagacccattttaaattatctgaaataaataaaataacgaacttcccacttcaatacacggctgatgaatcccagggcacatgaacaggttgagatgcatctttccattcacgacaccacaggaaactggcacagtcggtgacgcatctccttcgggaattgtgatctgcagtggtgttatagggcgcggaaaatcgtcgtttgccggatgctgtaaaaatatgaattattaaagcgatgtaattatgaaaaagtagctgaaactcactccatacaaaatttgataaacattcctttgactctcttggaatggagtcatcgtggaatgatgatgatcagatccttcggcttgaaatccatcacatgatccagaaatcggatgagacggcaacacggaagcagcgctcacgtctccaccgaacattttgacgttgctttgcaatccgaataaaaccgtgagtcgggcgggccgttgcaaagttcgccacgtttcacgttaacacgtaaagatttccgcgtcattctttttttcatctttttggtaccacttccgataagctgaaatttcttattattttcgttggcagataaataatgaattttttgttttaagaatatttattcaagagaaatggtttcaaaacgggaagaatccaacttttcagagagttttctttaattttttacaacaaaaacacaattttcacactaaacaacagttatttaaattaaaaatcacaagttgaacactttaaacgcgaaaaatagtgaaaaagttcataaaaaagcaaaagtgtgaaaataattgcagaacagaattttctacagtaaccttaaaggcgcacatacgaaatc