Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:159-d12   

Cenix:159-d12RNAiCenix:159-d12
PCR_productcenix:159-d12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF07B10.3 Source_evidenceePCR735WS150 Sequence/Annotation Release
Overlaps_Gene F07B10.3 Source_evidenceePCR735WS150 Sequence/Annotation Release
Chunk_score Abs_score610
Max_abs_score610F07B10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1127193211273485
Overlaps_transcriptF07B10.3 Source_evidenceePCR735WS150 Sequence/Annotation Release
WB_DNA_textTH:159-d121554ttgccaaaatggttaacacgtttggttcctagtgaatgaatttattgacaacattattcgttaaaaataatttcagctacctattgttggtgttacgcaatgagtttttccttgtttgcattacaatttttatatagatatgtggcagtatgcaagtaagttctgtaaaagtcaaaactgattagattcagaaatttagatgttaacagaaagtatttcatttgggattccagttagaaaacaacatttttcagaccgcaatatgttgatctttttgtcggatgtcacttttatgcttgggtagttttgatcttatcactagccacgagctggggactcactgcagctttcatgttcccacaaaccgaccgaacaactgaaatttttttgcacataatttatagttcatatgacttggagccttattggacagattatgttgcttataaatacgtacgatttttttgaattaaaacattttccaattggtaaaatttttgcagtttgatactgatgagaataatgtgagatgggtcaatgttcttagttttttcggtgtccttcagcacgggattgtaattgtgagaattttaaaacaggttaatcaaattttactacgaaaattcagactctaagttttggcaccctttattattgtggcatcaacacgtatctcaaaataaaaaaacacactggaacatcaaacagaactcgatgtattcaactacaacttttcagagctctggttgcacaggtaatattttttaatgtttttctacttttctataaattaattgcagacaattttaccaatgttcatgatgtatattcccgttggtttcatgtttgcatgtccatattttgacttgcaattaggtgcatacaccaattatcaaacagtcatggcacaactttatccgggaatcgacccatttgtgatgctgtttttgatagattcttatagaataacaatatttggtctgtttcatagtgatatcttaaacaataattccaatttctaggatggttatgtccaagatttgtttatgtaaagccgatgcattccacatacaccctaacttgaacaaagagctctactacagtatcactttctcacaggcgtctgtgtacactaatagtgcaaaattgacaaccgccaaaacacgagtattatcggcaacttgatgacatattggttgtcaagtgtatcacgtcactgaatagtacatcttttcatttaaatgatctctctattttcttaataatactactatgttttttgtgcaatgatattattttcttggctaaaactgtctgttaacaccctcgggttaaaaagacactagggaattgtgaatagactacgtctagtctaaccaattaattacgtatctctttgaaaatttgcttctaataacaatagttcctagccatagaggtgtgtaaatcacaaagcgtttagaccccatataattgggtttttagatacttaaaaatgccactcacataggctctagttaattgcgtgcatttctgctgccatttttgtttctg