Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:16-c7   

Cenix:16-c7RNAiCenix:16-c7
PCR_productcenix:16-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC31H1.8 Source_evidenceePCR1111WS150 Sequence/Annotation Release
Overlaps_Gene C31H1.8 Source_evidenceePCR1391WS150 Sequence/Annotation Release
Chunk_score Abs_score1286
Max_abs_score1286C31H1.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV58116465813332
Overlaps_transcriptC31H1.8 Source_evidenceePCR1391WS150 Sequence/Annotation Release
WB_DNA_textTH:16-c71687ttgtgtggtacgggagatgattggattatgtataaggggatcagggggcaagaaataatcgaatttatgaacctctaagtacccgtggtacacgaaaattatgagaaaaaataaaaaataaagcgagatggtggggggagcaactagagacactattatgggttataaatgacatatgaattggcaactttaagcatagtacaataagaacaataattgtggctctctctataacaataaatataaagttagaataaacattaacggaatgaagaagaatttaaagatcctctggagcatccttgatcaattcgagttctttaattgaagatttcatgttctccttctcatcttcagatgaagactcggaatctgaagtctccgaatccgcagcagtgtcttccgattccgaatattcagtaaattctggagatcttggctcagaactttcagacgagccaaccgattgtgtatcttcacatgtttctgatgacgctccatcgacaatcgatcgttttttcggatattttgaaaccgatttttctggagcatcgccgtcttccagttcctggattccagctttttcgagaagcaccaaaattaatgggaacatttccacgaaatcattgatttccagtggatcctcgatacttgcctgaaagatattttttcaattttaaaacttttttaaacagatttctggaagtttactttgtaaaacccaataaaaatggaaaagcgggggaaaatatcgtgttcgttgcctaataatgtttgatttggcactatttttggtttttttcttaaaataaataaattaaatcaaaaataatcaacgaaaacaggtggaaatcaattatttcagccagctactgtaatctcctttgcaaaattgattcttctcctcggggactacacaagatgcgtaaatcaacaattcacattttcttattaacctcaatctcagtttgttcttgctgctgctcatcgtcgggaatcggttctccagtgaccggattgaactgataagagctcttcaaacgaacttcttcgtcaacaatcagcggcggatgttcatccagaatctttgtgactggaacagacgtcggccgatgtcttatcagtgagaaatcacccaaacattcacaaacgagtccttcgtgctgtcgaacatctggaagtgacattcgagaacgccctgtcacgtggtcgacttgaacagactgaaaaaggagaaatacatttatcgaaaactgaaaatctctcacaatttgtctcattttcgtcttggcatctgagttacacggtttcaggcaacagaatttcacgataattgacacattcggagtgtgcggtgagttgattgtgaacgacgacacgtaggatattctcgcctgacgaattttcgattcaatttccataaatgaatcaatggcgcctcgcagtcgtctctcaagtttctcctgaaaatcaattaaataactattttttagaaaaaaaaaactatgctgaatttacatttctcgagtgaacaatagcgtagacgtagtcagaatgcatcttaactcctttgaatgttgcgtattcttcaataaagtcgtacaaagatttcagtgagacaacacaatctctgaattcaactctcagaagagtatcccttgaacagtcctctccagaccggatcata