Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:16-h11   

Cenix:16-h11RNAiCenix:16-h11
PCR_productcenix:16-h11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59A6.2 Source_evidenceePCR357WS150 Sequence/Annotation Release
Overlaps_Gene F59A6.2 Source_evidenceePCR357WS150 Sequence/Annotation Release
Chunk_score Abs_score315
Max_abs_score315F59A6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII50139275015441
Overlaps_transcriptF59A6.2 Source_evidenceePCR357WS150 Sequence/Annotation Release
WB_DNA_textTH:16-h111515ttccacctgctaagttggctaaccaatttcctttttttcagtaaaaaatgttgatgcccacgcctttttcctcatttctcaattcatcgtgaaagcggtcccaagagatattggagcgtgtattctcagacaaaattaagttttgttccagacgaggcggcacaaactccattttcatcacacgtttttctgtctcacaaatattgcagttcgttgtgtattctcaaatttattcaaaaatcaaaccacaaatatttgattcaattattttcataccctttgaaagttgtacaatttatttcgcaattttttgtatatctaattgaataatctttggaccttcttgatttttttccagctatttaattcaatgcagaacactatttgattcttttttctcaaagacgcaaaaaatgcctgattgtcttgaaggctgcttacgcctccttcgtgcctactgccaaatcataagcaagctgaactttcagtaaattaattgaactttttgaaaaccttgaatctacagtgtgccattaccaaaccattaccaaacaccgggactcgtcgagctaaaatgcaaaaaaataggtaggcacgcaggcaggcaagcattttttttaagggttttaatcttaaaacggttttcgtacaaattttacttttatttttcatttacaattttaaattttttattttttcgtaacccttttcacggacggaatttccccctctccccttcttcaaccaaaaaaatgtcagtttaaaaatttcgtagaataatttattctgaatttttcgattatcgaaaacgatcaagtatggcagaaggaggaactccagtggtggcaacaaaaccaccagtcgataatgcaaagatgttgggcgagctgaagctgagactgatgcacacgaagaagggactcctcgctattcgaggagagctacagagaagagctgaaatatggggagctgctcaagaggagatcactgcactggagaaaatggtatgtttattttgaaatttaatagatacttttgtagtttgctgctctaacacctgaaacgccttgactcctcatgggttatcttatgaacgcacctgaattaagagcgcccaaatcccttgaactcttaaatgctgaaatctaatcaataatttaattaatttcaggcgagcgatgcaaaggagaggatccagaagcagtcggaccaaaagagagaggagagaaagttggcggctcaaaaacgaaaggaattgaaacagaagcaaaaggaagagaaaaaagaagagtcaaaggatgagaaggatggagctgatgatgaaaagaacgatgagaattagcgaaactcttgcaaattgaaatttcggaataaacgttttgtaaaagcccttgtttttgtaattgttggaagttgatggcgaatttgttctaatgcctagaaattttatagacctatgttgaccggcgaacagttgaaatttttcaacgtctagataagcggccatattgcttg