Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:164-f6   

Cenix:164-f6RNAiCenix:164-f6
PCR_productcenix:164-f6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene M117.2 Source_evidenceePCR487WS150 Sequence/Annotation Release
Chunk_score Abs_score438
Max_abs_score438M117.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1182124811822368
Overlaps_transcript M117.2.3 Source_evidenceePCR480WS150 Sequence/Annotation Release
M117.2.2 Source_evidenceePCR487WS150 Sequence/Annotation Release
M117.2.1 Source_evidenceePCR487WS150 Sequence/Annotation Release
WB_DNA_textTH:164-f61121gagcctcctgaaagtcatgccatttacatcaagaatttagttattttcaaatacctggtaagccttctgggacttctcaacaacggcagcgcgatcctctgaagcgacctcggcgaggtatctgtagtaatctcctttcatcttgagatagaagaccttcgactcagcagctccagccttgacaatgaggaactcgtcgaggagcttgagcacatcttggcagatgtcgttgagttcttgctcaacctgaaataatgtaaataagttactaaaattcttgaaattaataaaatcttgcttggtgtagttaccttgacgcggtattccttggcgagttgttgcttcttctcggatccctcggtcttttgctcaatggaagagataactctccacgatgaacggcgagctccgacgacgtttttgtaggcaacagagagaaggttacgctcttcgttggaaagctcctgtccctgctcggtcacctgaaaaatagtaaatttgaaacctccgtaaatgatgttttatcttactttcttcatggcggcagccatatcatcgtatcgctcggcttgttcggcaagcttggcgcgttgaacgagctcttccacggtatcggacattttttcagtgagcaagtcttctgaaacaaaatttataatgaaatattgagaacgaaaagagaagaacataggcgagagtaataatcgaaacggagagccctagaacattcgaaacagcccgcacgacgtttgaaagaagaaaaatcgatggacagcagtgccggccgatgagagagcgcgtgccgccgccgtcgcatgacaacaactaaagtgggcaacgcacactcactcaatttgtgtctgtccgtctttttctctggcgcacacattcgctcctcatatatagcattgtctacacaaaaaatttcagattttttgggcatttgataagaaaacacgggaatagaaggatgaatggcagtggtgacaacgggcgcagcaagcacactaatctttcggtgagcacgttacacaaaactcaggaggtttcgtcaggacttttacctgaacaacgcaaaaaaataattttcgagaattgctaaatcgtgttggtggggatta